mirror of
https://github.com/boostorg/algorithm.git
synced 2026-01-30 07:02:10 +00:00
273 lines
11 KiB
C++
Executable File
273 lines
11 KiB
C++
Executable File
/*
|
|
Copyright (c) Marshall Clow 2010-2012.
|
|
|
|
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
|
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
|
|
|
For more information, see http://www.boost.org
|
|
*/
|
|
|
|
#include <boost/algorithm/searching/boyer_moore.hpp>
|
|
#include <boost/algorithm/searching/boyer_moore_horspool.hpp>
|
|
#include <boost/algorithm/searching/knuth_morris_pratt.hpp>
|
|
|
|
#include <boost/test/included/test_exec_monitor.hpp>
|
|
|
|
#include <iostream>
|
|
#include <string>
|
|
#include <vector>
|
|
|
|
|
|
namespace ba = boost::algorithm;
|
|
|
|
template <typename Iter>
|
|
std::string make_str ( Iter first, std::size_t len ) {
|
|
std::string retVal ( len + 2, '\'' );
|
|
std::copy ( first, first+len, retVal.begin () + 1);
|
|
return retVal;
|
|
}
|
|
|
|
namespace {
|
|
|
|
// Check using iterators
|
|
template<typename Container>
|
|
void check_one_iter ( const Container &haystack, const std::string &needle, int expected ) {
|
|
typedef typename Container::const_iterator iter_type;
|
|
typedef std::string::const_iterator pattern_type;
|
|
|
|
iter_type hBeg = haystack.begin ();
|
|
iter_type hEnd = haystack.end ();
|
|
pattern_type nBeg = needle.begin ();
|
|
pattern_type nEnd = needle.end ();
|
|
|
|
iter_type it0 = std::search (hBeg, hEnd, nBeg, nEnd);
|
|
iter_type it1 = ba::boyer_moore_search (hBeg, hEnd, nBeg, nEnd);
|
|
iter_type it1r = ba::boyer_moore_search (haystack, nBeg, nEnd);
|
|
iter_type it2 = ba::boyer_moore_horspool_search (hBeg, hEnd, nBeg, nEnd);
|
|
iter_type it3 = ba::knuth_morris_pratt_search (hBeg, hEnd, nBeg, nEnd);
|
|
const int dist = it1 == hEnd ? -1 : std::distance ( hBeg, it1 );
|
|
|
|
std::cout << "(Iterators) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl;
|
|
try {
|
|
if ( it0 != it1 ) {
|
|
throw std::runtime_error (
|
|
std::string ( "results mismatch between std::search and boyer-moore search" ));
|
|
}
|
|
|
|
if ( it1 != it1r ) {
|
|
throw std::runtime_error (
|
|
std::string ( "results mismatch between iterator and range boyer_moore search" ));
|
|
}
|
|
|
|
if ( it1 != it2 ) {
|
|
throw std::runtime_error (
|
|
std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" ));
|
|
}
|
|
|
|
if ( it1 != it3 )
|
|
throw std::runtime_error (
|
|
std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" ));
|
|
|
|
}
|
|
|
|
catch ( ... ) {
|
|
std::cout << "Searching for: " << needle << std::endl;
|
|
std::cout << "Expected: " << expected << "\n";
|
|
std::cout << " std: " << std::distance ( hBeg, it0 ) << "\n";
|
|
std::cout << " bm: " << std::distance ( hBeg, it1 ) << "\n";
|
|
std::cout << " bm(r): " << std::distance ( hBeg, it1r ) << "\n";
|
|
std::cout << " bmh: " << std::distance ( hBeg, it2 ) << "\n";
|
|
std::cout << " kpm: " << std::distance ( hBeg, it3 )<< "\n";
|
|
std::cout << std::flush;
|
|
throw ;
|
|
}
|
|
|
|
BOOST_CHECK_EQUAL ( dist, expected );
|
|
}
|
|
|
|
// Check using pointers
|
|
// We're assuming that the container implements contiguous storage here.
|
|
template<typename Container>
|
|
void check_one_pointer ( const Container &haystack, const std::string &needle, int expected ) {
|
|
typedef const typename Container::value_type *ptr_type;
|
|
ptr_type hBeg = haystack.size () == 0 ? NULL : &*haystack.begin ();
|
|
ptr_type hEnd = hBeg + haystack.size ();
|
|
ptr_type nBeg = needle.size () == 0 ? NULL : &*needle.begin ();
|
|
ptr_type nEnd = nBeg + needle.size ();
|
|
|
|
ptr_type it0 = std::search (hBeg, hEnd, nBeg, nEnd);
|
|
ptr_type it1 = ba::boyer_moore_search (hBeg, hEnd, nBeg, nEnd);
|
|
ptr_type it2 = ba::boyer_moore_horspool_search (hBeg, hEnd, nBeg, nEnd);
|
|
ptr_type it3 = ba::knuth_morris_pratt_search (hBeg, hEnd, nBeg, nEnd);
|
|
const int dist = it1 == hEnd ? -1 : std::distance ( hBeg, it1 );
|
|
|
|
std::cout << "(Pointers) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl;
|
|
try {
|
|
if ( it0 != it1 ) {
|
|
throw std::runtime_error (
|
|
std::string ( "results mismatch between std::search and boyer-moore search" ));
|
|
}
|
|
|
|
if ( it1 != it2 ) {
|
|
throw std::runtime_error (
|
|
std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" ));
|
|
}
|
|
|
|
if ( it1 != it3 )
|
|
throw std::runtime_error (
|
|
std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" ));
|
|
|
|
}
|
|
|
|
catch ( ... ) {
|
|
std::cout << "Searching for: " << needle << std::endl;
|
|
std::cout << "Expected: " << expected << "\n";
|
|
std::cout << " std: " << std::distance ( hBeg, it0 ) << "\n";
|
|
std::cout << " bm: " << std::distance ( hBeg, it1 ) << "\n";
|
|
std::cout << " bmh: " << std::distance ( hBeg, it2 ) << "\n";
|
|
std::cout << " kpm: " << std::distance ( hBeg, it3 )<< "\n";
|
|
std::cout << std::flush;
|
|
throw ;
|
|
}
|
|
|
|
BOOST_CHECK_EQUAL ( dist, expected );
|
|
}
|
|
|
|
// Check using objects
|
|
template<typename Container>
|
|
void check_one_object ( const Container &haystack, const std::string &needle, int expected ) {
|
|
typedef typename Container::const_iterator iter_type;
|
|
typedef std::string::const_iterator pattern_type;
|
|
|
|
iter_type hBeg = haystack.begin ();
|
|
iter_type hEnd = haystack.end ();
|
|
pattern_type nBeg = needle.begin ();
|
|
pattern_type nEnd = needle.end ();
|
|
|
|
ba::boyer_moore<pattern_type> bm_r = ba::make_boyer_moore ( needle );
|
|
ba::boyer_moore<pattern_type> bm ( nBeg, nEnd );
|
|
ba::boyer_moore_horspool<pattern_type> bmh ( nBeg, nEnd );
|
|
ba::knuth_morris_pratt<pattern_type> kmp ( nBeg, nEnd );
|
|
|
|
iter_type it0 = std::search (hBeg, hEnd, nBeg, nEnd);
|
|
iter_type it1 = bm (hBeg, hEnd);
|
|
iter_type it1r = bm (haystack);
|
|
iter_type rt1 = bm_r (hBeg, hEnd);
|
|
iter_type rt1r = bm_r (haystack);
|
|
iter_type it2 = bmh (hBeg, hEnd);
|
|
iter_type it3 = kmp (hBeg, hEnd);
|
|
const int dist = it1 == hEnd ? -1 : std::distance ( hBeg, it1 );
|
|
|
|
std::cout << "(Objects) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl;
|
|
try {
|
|
if ( it0 != it1 ) {
|
|
throw std::runtime_error (
|
|
std::string ( "results mismatch between std::search and boyer-moore search" ));
|
|
}
|
|
|
|
if ( it1 != it1r ) {
|
|
throw std::runtime_error (
|
|
std::string ( "results mismatch between iterator and range boyer_moore search(1)" ));
|
|
}
|
|
|
|
if ( it1 != rt1 ) {
|
|
throw std::runtime_error (
|
|
std::string ( "results mismatch between iterator and range boyer_moore search(2)" ));
|
|
}
|
|
|
|
if ( rt1 != rt1r ) {
|
|
throw std::runtime_error (
|
|
std::string ( "results mismatch between iterator and range boyer_moore search(3)" ));
|
|
}
|
|
|
|
if ( it1 != it2 ) {
|
|
throw std::runtime_error (
|
|
std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" ));
|
|
}
|
|
|
|
if ( it1 != it3 )
|
|
throw std::runtime_error (
|
|
std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" ));
|
|
|
|
}
|
|
|
|
catch ( ... ) {
|
|
std::cout << "Searching for: " << needle << std::endl;
|
|
std::cout << "Expected: " << expected << "\n";
|
|
std::cout << " std: " << std::distance ( hBeg, it0 ) << "\n";
|
|
std::cout << " bm: " << std::distance ( hBeg, it1 ) << "\n";
|
|
std::cout << " bm(r1): " << std::distance ( hBeg, it1r ) << "\n";
|
|
std::cout << " bm(r2): " << std::distance ( hBeg, rt1 ) << "\n";
|
|
std::cout << " bm(r3): " << std::distance ( hBeg, rt1r ) << "\n";
|
|
std::cout << " bmh: " << std::distance ( hBeg, it2 ) << "\n";
|
|
std::cout << " kpm: " << std::distance ( hBeg, it3 )<< "\n";
|
|
std::cout << std::flush;
|
|
throw ;
|
|
}
|
|
|
|
BOOST_CHECK_EQUAL ( dist, expected );
|
|
}
|
|
|
|
|
|
template<typename Container>
|
|
void check_one ( const Container &haystack, const std::string &needle, int expected ) {
|
|
check_one_iter ( haystack, needle, expected );
|
|
check_one_pointer ( haystack, needle, expected );
|
|
check_one_object ( haystack, needle, expected );
|
|
}
|
|
}
|
|
|
|
|
|
int test_main( int , char* [] )
|
|
{
|
|
std::string haystack1 ( "NOW AN FOWE\220ER ANNMAN THE ANPANMANEND" );
|
|
std::string needle1 ( "ANPANMAN" );
|
|
std::string needle2 ( "MAN THE" );
|
|
std::string needle3 ( "WE\220ER" );
|
|
std::string needle4 ( "NOW " ); // At the beginning
|
|
std::string needle5 ( "NEND" ); // At the end
|
|
std::string needle6 ( "NOT FOUND" ); // Nowhere
|
|
std::string needle7 ( "NOT FO\340ND" ); // Nowhere
|
|
|
|
std::string haystack2 ( "ABC ABCDAB ABCDABCDABDE" );
|
|
std::string needle11 ( "ABCDABD" );
|
|
|
|
std::string haystack3 ( "abra abracad abracadabra" );
|
|
std::string needle12 ( "abracadabra" );
|
|
|
|
std::string needle13 ( "" );
|
|
std::string haystack4 ( "" );
|
|
|
|
check_one ( haystack1, needle1, 26 );
|
|
check_one ( haystack1, needle2, 18 );
|
|
check_one ( haystack1, needle3, 9 );
|
|
check_one ( haystack1, needle4, 0 );
|
|
check_one ( haystack1, needle5, 33 );
|
|
check_one ( haystack1, needle6, -1 );
|
|
check_one ( haystack1, needle7, -1 );
|
|
|
|
check_one ( needle1, haystack1, -1 ); // cant find long pattern in short corpus
|
|
check_one ( haystack1, haystack1, 0 ); // find something in itself
|
|
check_one ( haystack2, haystack2, 0 ); // find something in itself
|
|
|
|
check_one ( haystack2, needle11, 15 );
|
|
check_one ( haystack3, needle12, 13 );
|
|
|
|
check_one ( haystack1, needle13, 0 ); // find the empty string
|
|
check_one ( haystack4, needle1, -1 ); // can't find in an empty haystack
|
|
|
|
// Mikhail Levin <svarneticist@gmail.com> found a problem, and this was the test
|
|
// that triggered it.
|
|
|
|
const std::string mikhail_pattern =
|
|
"GATACACCTACCTTCACCAGTTACTCTATGCACTAGGTGCGCCAGGCCCATGCACAAGGGCTTGAGTGGATGGGAAGGA"
|
|
"TGTGCCCTAGTGATGGCAGCATAAGCTACGCAGAGAAGTTCCAGGGCAGAGTCACCATGACCAGGGACACATCCACGAG"
|
|
"CACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCCATGTATTACTGTGGGAGAGATGTCTGGAGTGGT"
|
|
"TATTATTGCCCCGGTAATATTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACG"
|
|
;
|
|
const std::string mikhail_corpus = std::string (8, 'a') + mikhail_pattern;
|
|
|
|
check_one ( mikhail_corpus, mikhail_pattern, 8 );
|
|
return 0;
|
|
}
|