Compare commits

...

71 Commits

Author SHA1 Message Date
Christopher Hite
280f150bfb optional_optimization branch
[SVN r77091]
2012-02-22 10:37:27 +00:00
Marshall Clow
dfaea65083 Fix (even more) test failures in Boost.Algorithm
[SVN r77076]
2012-02-20 15:22:04 +00:00
Marshall Clow
eb8291e0aa Fix some test (more) failures in Boost.Algorithm
[SVN r77073]
2012-02-19 16:17:27 +00:00
Marshall Clow
f023127c99 Fix some test failures in Boost.Algorithm
[SVN r77070]
2012-02-18 17:26:08 +00:00
Marshall Clow
43c01ff2bc Added c++11 algorithms to Boost.Algorithm
[SVN r77060]
2012-02-18 07:17:39 +00:00
Marshall Clow
8bfaa6dad3 Added QuickRef entries for 'is_any_of' and 'is_from_range'
[SVN r76526]
2012-01-15 16:47:48 +00:00
Marshall Clow
6fbc7401d5 should correct #3634; will close when merged to release
[SVN r76435]
2012-01-12 18:35:06 +00:00
Marshall Clow
d518994247 Initial checkin of Boost.Algorithm searching and clamp code and tests; docs and more Algos coming
[SVN r76388]
2012-01-09 17:21:04 +00:00
Marshall Clow
ba417e875a Qualified two calls to memcpy to work around a C++Builder bug; Refs #4811
[SVN r76213]
2011-12-28 19:14:18 +00:00
Pavol Droba
e92d471817 Comment updated
[SVN r72350]
2011-06-02 20:08:16 +00:00
Pavol Droba
34c49f856c trim_fill algorithm added
[SVN r72338]
2011-06-01 22:00:22 +00:00
Pavol Droba
caea7bd125 trim_all test fixed
[SVN r68173]
2011-01-15 18:37:46 +00:00
Steven Watanabe
81b04cde96 Revert [67111] (addition of boost/detail/iomanip.hpp) and all the commits that depend on it. ([68137], [68140], [68141], [68154], and [68165]).
[SVN r68168]
2011-01-15 08:11:51 +00:00
Pavol Droba
276073ca64 tabs removed
[SVN r68162]
2011-01-14 23:12:32 +00:00
Pavol Droba
a7f5bdd781 trim_all algorithm added
[SVN r68161]
2011-01-14 23:06:14 +00:00
Bryce Adelstein-Lelbach
0c0a866f07 Replacing the use of <iomanip> with <boost/detail/iomanip.hpp> across Boost.
On Linux, GNU's libstdc++, which is the default stdlib for icc and clang,
cannot parse the <iomanip> header in version 4.5+ (which thankfully neither
compiler advises the use of yet), as it's original C++98-friendly
implementation has been replaced with a gnu++0x implementation.
<boost/detail/iomanip.hpp> is a portable implementation of <iomanip>, providing
boost::detail::setfill, boost::detail::setbase, boost::detail::setw,
boost::detail::setprecision, boost::detail::setiosflags and
boost::detail::resetiosflags. 



[SVN r68140]
2011-01-14 02:35:58 +00:00
Pavol Droba
9d25072f2f dissect formatter and tests added
[SVN r68124]
2011-01-13 21:21:37 +00:00
Steven Watanabe
823b199df3 Fix typo. Fixes #4937.
[SVN r67106]
2010-12-08 17:37:52 +00:00
Daniel James
fecd440527 Fix some links I missed in string algorithms
[SVN r66278]
2010-10-30 15:53:41 +00:00
Daniel James
3325d3a3f8 Link fixes.
[SVN r66273]
2010-10-30 14:32:50 +00:00
Pavol Droba
ebf104c127 test for empty string split added
[SVN r66221]
2010-10-27 20:42:22 +00:00
Pavol Droba
3b76763807 fixed the empty string handling for the split iterator
[SVN r66220]
2010-10-27 20:40:37 +00:00
Jürgen Hunold
62df1eb048 Fix #4551,#4553,#4575 by removing unused parameter.
[SVN r65004]
2010-08-25 20:01:38 +00:00
Daniel James
f5dd47883f Update various libraries' documentation build.
Mostly to use the images and css files under doc/src instead of
doc/html, usually be deleting the settings in order to use the defaults.
Also add 'boost.root' to some builds in order to fix links which rely on
it.

[SVN r63146]
2010-06-20 18:00:48 +00:00
K. Noel Belcourt
9d68c4280c Fix license per inspection report.
[SVN r62814]
2010-06-11 19:52:26 +00:00
Steven Watanabe
1e8b3ee752 Make to_upperF and to_lowerF assignable. Fixes #3161.
[SVN r62697]
2010-06-09 23:23:56 +00:00
Steven Watanabe
42147c8385 Copy m_bEof in the split_iterator copy constructor. Fixes #4271
[SVN r62696]
2010-06-09 23:12:56 +00:00
Steven Watanabe
672775545d Avoid calling the formatter with an invalid match. Fixes #2777
[SVN r62695]
2010-06-09 23:04:24 +00:00
Steven Watanabe
46ed1bf987 Assign the iterator returned by std::copy back to Output, so that string algorithms will work with iterators other than inserters
[SVN r62694]
2010-06-09 21:12:06 +00:00
Steven Watanabe
6289ed7f98 Trim the correct string. Fixes #3860
[SVN r62692]
2010-06-09 20:42:46 +00:00
Steven Watanabe
8e97668b1f Tail not head. Fixes #3314
[SVN r62690]
2010-06-09 20:31:26 +00:00
Steven Watanabe
e7c23d2f13 Tail not head. Fixes #2124
[SVN r62689]
2010-06-09 20:26:36 +00:00
Steven Watanabe
a1e7512012 Use result_type instead of sig for predicates. Fixes #2868
[SVN r62688]
2010-06-09 20:16:21 +00:00
Daniel James
31b5842441 Typo.
[SVN r62461]
2010-06-06 07:18:24 +00:00
Steven Watanabe
4515bc182e Fix example. Fixes #4206
[SVN r61931]
2010-05-12 12:56:16 +00:00
Steven Watanabe
7e2e6856cc Remove duplicate closing angle brackets. Fixes #4198
[SVN r61856]
2010-05-08 18:27:44 +00:00
Jeremiah Willcock
235c81be61 Fixed various issues in docs (mostly duplicate bookmarks and broken links) found by inspect tool
[SVN r61437]
2010-04-20 18:49:18 +00:00
Daniel James
1eb3d83534 Fix links for string algorithm to range documentation.
[SVN r61351]
2010-04-18 12:17:36 +00:00
Troy D. Straszheim
8f2b8d4888 rm cmake from trunk. I'm not entirely sure this is necessary to satisfy the inspect script, but I'm not taking any chances, and it is easy to put back
[SVN r56942]
2009-10-17 02:07:38 +00:00
Pavol Droba
6c0f953c01 GCC compilation errors caused be the recent update fixed
[SVN r55434]
2009-08-06 19:52:08 +00:00
Pavol Droba
e439792494 Merged ADL protection patch from Neil Groves
[SVN r55424]
2009-08-05 20:01:10 +00:00
Troy D. Straszheim
236b142308 Copyrights on CMakeLists.txt to keep them from clogging up the inspect
reports.  This is essentially the same commit as r55095 on the release
branch.



[SVN r55159]
2009-07-26 00:49:56 +00:00
Steven Watanabe
9bad789175 Fix operator precedence error in documentation. Fixes #2122
[SVN r53520]
2009-06-01 00:47:03 +00:00
Jeremiah Willcock
d84f81d841 Fixed most tab and min/max issues from trunk inspection report
[SVN r53141]
2009-05-20 19:19:00 +00:00
Steven Watanabe
ce98e8b87e Qualify minmax with boost:: to avoid ambiguity with std::minmax. Fixes #3023
[SVN r53062]
2009-05-17 00:39:22 +00:00
John Maddock
e8a2596637 Add PDF generation options to fix external links to point to the web site.
Added a few more Boostbook based libs that were missed first time around.
Fixed PDF naming issues.

[SVN r51284]
2009-02-17 10:05:58 +00:00
Steven Watanabe
7b2754b937 Fix copy/paste error in minmax docs. Fixes #2500
[SVN r51045]
2009-02-06 03:45:09 +00:00
Michael A. Jackson
784402e5c0 Updating dependency information for modularized libraries.
[SVN r49628]
2008-11-07 17:05:27 +00:00
Michael A. Jackson
1188575e7b Updating CMake files to latest trunk. Added dependency information for regression tests and a few new macros for internal use.
[SVN r49627]
2008-11-07 17:02:56 +00:00
Michael A. Jackson
bff2a1e112 Continuing merge of CMake build system files into trunk with the encouragement of Doug Gregor
[SVN r49510]
2008-11-01 13:15:41 +00:00
Pavol Droba
6d5e7b5a04 self assignment problem in is_any_ofF fixed
[SVN r48281]
2008-08-21 14:46:15 +00:00
Pavol Droba
760af1798b removed static constant FIXED_STORAGE_SIZE from is_any_of to
make the code compile on borland compilers



[SVN r48218]
2008-08-19 14:32:59 +00:00
Pavol Droba
1f5542b44c predicate test improvements
[SVN r48199]
2008-08-18 18:33:40 +00:00
Pavol Droba
baf3dd99e2 fox for allocation bug in is_any_ofF
[SVN r48198]
2008-08-18 18:32:51 +00:00
Pavol Droba
7299b29bf8 fixind the problems in is_any_ofF spotted by gcc
[SVN r46498]
2008-06-18 22:07:32 +00:00
Pavol Droba
539c170b9d aditional tests added
[SVN r46497]
2008-06-18 21:55:38 +00:00
Pavol Droba
c81ee948b7 is_any_ofF performance improvements
tabs removed



[SVN r46496]
2008-06-18 21:54:06 +00:00
Pavol Droba
ba5e4c30c6 fixed the rle example crash
[SVN r46463]
2008-06-17 21:58:58 +00:00
Pavol Droba
cd26ed816c patch from ticket #1152 applied
[SVN r46461]
2008-06-17 21:21:33 +00:00
Pavol Droba
4e15767bed simple_finder example fixed
[SVN r46460]
2008-06-17 21:13:25 +00:00
Pavol Droba
9fa2f90db4 begin() and end() calls made fully qualified
[SVN r46459]
2008-06-17 21:04:00 +00:00
Pavol Droba
35f317aeac unnecessary typedefs removed
[SVN r46458]
2008-06-17 20:31:41 +00:00
Markus Schöpflin
d0a03fdb4e Added missing include. This was already fixed on the 1.34 branch but never merged to the trunk.
[SVN r45857]
2008-05-28 08:32:12 +00:00
Daniel James
346f032be2 Quote href values - our tools don't support unquoted values.
[SVN r45283]
2008-05-11 13:49:20 +00:00
Daniel James
a389d768c4 Fix broken copyright urls. Fixes #1573.
[SVN r43422]
2008-02-27 18:51:14 +00:00
Daniel James
90fca39906 Point links to the pages that used to be in 'more' to the site.
[SVN r43210]
2008-02-10 15:02:17 +00:00
Pavol Droba
5b24f31486 merging changes from 1.34
[SVN r40698]
2007-11-02 21:00:08 +00:00
Pavol Droba
b25d6511b3 merging changes from 1.34
[SVN r40697]
2007-11-02 20:55:26 +00:00
Thorsten Jørgen Ottosen
1541a554f5 changed range_result_iterator to range_iterator
[SVN r40518]
2007-10-27 22:52:29 +00:00
Markus Schöpflin
7a97b3390e Added missing include.
[SVN r39586]
2007-09-28 07:19:29 +00:00
Markus Schöpflin
6e5a7497ae Added missing include.
[SVN r39519]
2007-09-25 08:46:31 +00:00
103 changed files with 49657 additions and 747 deletions

22
example/Jamfile.v2 Normal file
View File

@@ -0,0 +1,22 @@
# Boost algorithm library example programs Jamfile
#
# Copyright Marshall Clow 2010-2012. Use, modification and
# distribution is subject to the Boost Software License, Version
# 1.0. (See accompanying file LICENSE_1_0.txt or copy at
# http://www.boost.org/LICENSE_1_0.txt)
#
# See http://www.boost.org for updates, documentation, and revision history.
project /boost/algorithm/example
: requirements
<include>../../../
<optimization>speed
<toolset>msvc:<define>_SCL_SECURE_NO_WARNINGS
<toolset>msvc:<define>NOMINMAX
<link>static
:
;
exe clamp_example : clamp_example.cpp ;
exe search_example : search_example.cpp ;

54
example/clamp_example.cpp Normal file
View File

@@ -0,0 +1,54 @@
/*
Copyright (c) Marshall Clow 2010-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
For more information, see http://www.boost.org
*/
#include <string>
#include <iostream> // for cout, etc
#include <boost/algorithm/clamp.hpp>
namespace ba = boost::algorithm;
bool compare_string_lengths ( const std::string &one, const std::string &two )
{
return one.length () < two.length ();
}
int main ( int /*argc*/, char * /*argv*/ [] ) {
// Clamp takes a value and two "fenceposts", and brings the value "between" the fenceposts.
// If the input value is "between" the fenceposts, then it is returned unchanged.
std::cout << "Clamping 5 to between [1, 10] -> " << ba::clamp ( 5, 1, 10 ) << std::endl;
// If the input value is out side the range of the fenceposts, it "brought into" range.
std::cout << "Clamping 15 to between [1, 10] -> " << ba::clamp ( 15, 1, 10 ) << std::endl;
std::cout << "Clamping -15 to between [1, 10] -> " << ba::clamp ( -15, 1, 10 ) << std::endl;
// It doesn't just work for ints
std::cout << "Clamping 5.1 to between [1, 10] -> " << ba::clamp ( 5.1, 1.0, 10.0 ) << std::endl;
{
std::string one ( "Lower Bound" ), two ( "upper bound!" ), test1 ( "test#" ), test2 ( "#test" );
std::cout << "Clamping '" << test1 << "' between ['" << one << "' and '" << two << "'] -> '" <<
ba::clamp ( test1, one, two ) << "'" << std::endl;
std::cout << "Clamping '" << test2 << "' between ['" << one << "' and '" << two << "'] -> '" <<
ba::clamp ( test2, one, two ) << "'" << std::endl;
// There is also a predicate based version, if you want to compare objects in your own way
std::cout << "Clamping '" << test1 << "' between ['" << one << "' and '" << two << "'] (comparing lengths) -> '" <<
ba::clamp ( test1, one, two, compare_string_lengths ) << "'" << std::endl;
std::cout << "Clamping '" << test2 << "' between ['" << one << "' and '" << two << "'] (comparing lengths) -> '" <<
ba::clamp ( test2, one, two, compare_string_lengths ) << "'" << std::endl;
}
// Sometimes, though, you don't get quite what you expect
// This is because the two double arguments get converted to int
std::cout << "Somewhat unexpected: clamp ( 12, 14.7, 15.9 ) --> " << ba::clamp ( 12, 14.7, 15.9 ) << std::endl;
std::cout << "Expected: clamp ((double)12, 14.7, 15.9 ) --> " << ba::clamp ((double) 12, 14.7, 15.9 ) << std::endl;
return 0;
}

View File

@@ -0,0 +1,57 @@
/*
Copyright (c) Marshall Clow 2010-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
For more information, see http://www.boost.org
*/
#include <string>
#include <iostream> // for cout, etc.
#include <boost/algorithm/searching/boyer_moore.hpp>
#include <boost/algorithm/searching/boyer_moore_horspool.hpp>
#include <boost/algorithm/searching/knuth_morris_pratt.hpp>
namespace ba = boost::algorithm;
const std::string haystack ( "ABACAB is it everywhere!" );
const std::string needle1 ( "ACAB" );
const std::string needle2 ( "not ABA" );
int main ( int /*argc*/, char * /*argv*/ [] ) {
// In search.hpp, there are generic implementations of three classic sequence search
// algorithms. They all have the same (dual) interface.
// There is a procedural interface, based on std::search:
if ( ba::boyer_moore_search ( haystack.begin (), haystack.end (), needle1.begin (), needle1.end ()) != haystack.end ())
std::cout << "Found '" << needle1 << "' in '" << haystack << "' (boyer-moore 1)" << std::endl;
else
std::cout << "Did NOT find '" << needle1 << "' in '" << haystack << "' (boyer-moore 1)" << std::endl;
// If you plan on searching for the same pattern in several different data sets,
// you can create a search object and use that over and over again - amortizing the setup
// costs across several searches
ba::boyer_moore<std::string::const_iterator> search1 ( needle1.begin (), needle1.end ());
if ( search1 ( haystack.begin (), haystack.end ()) != haystack.end ())
std::cout << "Found '" << needle1 << "' in '" << haystack << "' (boyer-moore 2)" << std::endl;
else
std::cout << "Did NOT find '" << needle1 << "' in '" << haystack << "' (boyer-moore 2)" << std::endl;
// There is also an implementation of boyer-moore-horspool searching
if ( ba::boyer_moore_horspool_search ( haystack.begin (), haystack.end (), needle1.begin (), needle1.end ()) != haystack.end ())
std::cout << "Found '" << needle1 << "' in '" << haystack << "' (boyer-moore-horspool)" << std::endl;
else
std::cout << "Did NOT find '" << needle1 << "' in '" << haystack << "' (boyer-moore-horspool)" << std::endl;
// And also the knuth-pratt-morris search algorithm
if ( ba::knuth_morris_pratt_search ( haystack.begin (), haystack.end (), needle1.begin (), needle1.end ()) != haystack.end ())
std::cout << "Found '" << needle1 << "' in '" << haystack << "' (knuth_morris_pratt)" << std::endl;
else
std::cout << "Did NOT find '" << needle1 << "' in '" << haystack << "' (knuth_morris_pratt)" << std::endl;
return 0;
}

175
include/boost/algorithm/clamp.hpp Executable file
View File

@@ -0,0 +1,175 @@
/*
Copyright (c) Marshall Clow 2008-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
Revision history:
27 June 2009 mtc First version
23 Oct 2010 mtc Added predicate version
*/
/// \file clamp.hpp
/// \brief Clamp algorithm
/// \author Marshall Clow
///
/// Suggested by olafvdspek in https://svn.boost.org/trac/boost/ticket/3215
#ifndef BOOST_ALGORITHM_CLAMP_HPP
#define BOOST_ALGORITHM_CLAMP_HPP
#include <functional> // For std::less
#include <iterator> // For std::iterator_traits
#include <cassert>
#include <boost/range/begin.hpp>
#include <boost/range/end.hpp>
#include <boost/mpl/identity.hpp> // for identity
#include <boost/utility/enable_if.hpp> // for boost::disable_if
namespace boost { namespace algorithm {
/// \fn clamp ( T const& val,
/// typename boost::mpl::identity<T>::type const& lo,
/// typename boost::mpl::identity<T>::type const& hi, Pred p )
/// \return the value "val" brought into the range [ lo, hi ]
/// using the comparison predicate p.
/// If p ( val, lo ) return lo.
/// If p ( hi, val ) return hi.
/// Otherwise, return the original value.
///
/// \param val The value to be clamped
/// \param lo The lower bound of the range to be clamped to
/// \param hi The upper bound of the range to be clamped to
/// \param p A predicate to use to compare the values.
/// p ( a, b ) returns a boolean.
///
template<typename T, typename Pred>
T const & clamp ( T const& val,
typename boost::mpl::identity<T>::type const & lo,
typename boost::mpl::identity<T>::type const & hi, Pred p )
{
// assert ( !p ( hi, lo )); // Can't assert p ( lo, hi ) b/c they might be equal
return p ( val, lo ) ? lo : p ( hi, val ) ? hi : val;
}
/// \fn clamp ( T const& val,
/// typename boost::mpl::identity<T>::type const& lo,
/// typename boost::mpl::identity<T>::type const& hi )
/// \return the value "val" brought into the range [ lo, hi ].
/// If the value is less than lo, return lo.
/// If the value is greater than "hi", return hi.
/// Otherwise, return the original value.
///
/// \param val The value to be clamped
/// \param lo The lower bound of the range to be clamped to
/// \param hi The upper bound of the range to be clamped to
///
template<typename T>
T const& clamp ( const T& val,
typename boost::mpl::identity<T>::type const & lo,
typename boost::mpl::identity<T>::type const & hi )
{
return (clamp) ( val, lo, hi, std::less<T>());
}
/// \fn clamp_range ( InputIterator first, InputIterator last, OutputIterator out,
/// std::iterator_traits<InputIterator>::value_type lo,
/// std::iterator_traits<InputIterator>::value_type hi )
/// \return clamp the sequence of values [first, last) into [ lo, hi ]
///
/// \param first The start of the range of values
/// \param last One past the end of the range of input values
/// \param out An output iterator to write the clamped values into
/// \param lo The lower bound of the range to be clamped to
/// \param hi The upper bound of the range to be clamped to
///
template<typename InputIterator, typename OutputIterator>
OutputIterator clamp_range ( InputIterator first, InputIterator last, OutputIterator out,
typename std::iterator_traits<InputIterator>::value_type lo,
typename std::iterator_traits<InputIterator>::value_type hi )
{
// this could also be written with bind and std::transform
while ( first != last )
*out++ = clamp ( *first++, lo, hi );
return out;
}
/// \fn clamp_range ( const Range &r, OutputIterator out,
/// typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type lo,
/// typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type hi )
/// \return clamp the sequence of values [first, last) into [ lo, hi ]
///
/// \param r The range of values to be clamped
/// \param out An output iterator to write the clamped values into
/// \param lo The lower bound of the range to be clamped to
/// \param hi The upper bound of the range to be clamped to
///
template<typename Range, typename OutputIterator>
typename boost::disable_if_c<boost::is_same<Range, OutputIterator>::value, OutputIterator>::type
clamp_range ( const Range &r, OutputIterator out,
typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type lo,
typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type hi )
{
return clamp_range ( boost::begin ( r ), boost::end ( r ), out, lo, hi );
}
/// \fn clamp_range ( InputIterator first, InputIterator last, OutputIterator out,
/// std::iterator_traits<InputIterator>::value_type lo,
/// std::iterator_traits<InputIterator>::value_type hi, Pred p )
/// \return clamp the sequence of values [first, last) into [ lo, hi ]
/// using the comparison predicate p.
///
/// \param first The start of the range of values
/// \param last One past the end of the range of input values
/// \param out An output iterator to write the clamped values into
/// \param lo The lower bound of the range to be clamped to
/// \param hi The upper bound of the range to be clamped to
/// \param p A predicate to use to compare the values.
/// p ( a, b ) returns a boolean.
///
template<typename InputIterator, typename OutputIterator, typename Pred>
OutputIterator clamp_range ( InputIterator first, InputIterator last, OutputIterator out,
typename std::iterator_traits<InputIterator>::value_type lo,
typename std::iterator_traits<InputIterator>::value_type hi, Pred p )
{
// this could also be written with bind and std::transform
while ( first != last )
*out++ = clamp ( *first++, lo, hi, p );
return out;
}
/// \fn clamp_range ( const Range &r, OutputIterator out,
/// typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type lo,
/// typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type hi,
/// Pred p )
/// \return clamp the sequence of values [first, last) into [ lo, hi ]
/// using the comparison predicate p.
///
/// \param r The range of values to be clamped
/// \param out An output iterator to write the clamped values into
/// \param lo The lower bound of the range to be clamped to
/// \param hi The upper bound of the range to be clamped to
/// \param p A predicate to use to compare the values.
/// p ( a, b ) returns a boolean.
//
// Disable this template if the first two parameters are the same type;
// In that case, the user will get the two iterator version.
template<typename Range, typename OutputIterator, typename Pred>
typename boost::disable_if_c<boost::is_same<Range, OutputIterator>::value, OutputIterator>::type
clamp_range ( const Range &r, OutputIterator out,
typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type lo,
typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type hi,
Pred p )
{
return clamp_range ( boost::begin ( r ), boost::end ( r ), out, lo, hi, p );
}
}}
#endif // BOOST_ALGORITHM_CLAMP_HPP

View File

@@ -0,0 +1,90 @@
/*
Copyright (c) Marshall Clow 2008-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
*/
/// \file all_of.hpp
/// \brief Test ranges to see if all elements match a value or predicate.
/// \author Marshall Clow
#ifndef BOOST_ALGORITHM_ALL_OF_HPP
#define BOOST_ALGORITHM_ALL_OF_HPP
#include <boost/range/begin.hpp>
#include <boost/range/end.hpp>
namespace boost { namespace algorithm {
#if __cplusplus >= 201103L
// Use the C++11 versions of all_of if it is available
using std::all_of; // Section 25.2.1
#else
/// \fn all_of ( InputIterator first, InputIterator last, Predicate p )
/// \return true if all elements in [first, last) satisfy the predicate 'p'
/// \note returns true on an empty range
///
/// \param first The start of the input sequence
/// \param last One past the end of the input sequence
/// \param p A predicate for testing the elements of the sequence
///
/// \note This function is part of the C++2011 standard library.
/// We will use the standard one if it is available,
/// otherwise we have our own implementation.
template<typename InputIterator, typename Predicate>
bool all_of ( InputIterator first, InputIterator last, Predicate p )
{
for ( ; first != last; ++first )
if ( !p(*first))
return false;
return true;
}
#endif
/// \fn all_of ( const Range &r, Predicate p )
/// \return true if all elements in the range satisfy the predicate 'p'
/// \note returns true on an empty range
///
/// \param r The input range
/// \param p A predicate for testing the elements of the range
///
template<typename Range, typename Predicate>
bool all_of ( const Range &r, Predicate p )
{
return boost::algorithm::all_of ( boost::begin (r), boost::end (r), p );
}
/// \fn all_of_equal ( InputIterator first, InputIterator last, const T &val )
/// \return true if all elements in [first, last) are equal to 'val'
/// \note returns true on an empty range
///
/// \param first The start of the input sequence
/// \param last One past the end of the input sequence
/// \param val A value to compare against
///
template<typename InputIterator, typename T>
bool all_of_equal ( InputIterator first, InputIterator last, const T &val )
{
for ( ; first != last; ++first )
if ( val != *first )
return false;
return true;
}
/// \fn all_of_equal ( const Range &r, const T &val )
/// \return true if all elements in the range are equal to 'val'
/// \note returns true on an empty range
///
/// \param r The input range
/// \param val A value to compare against
///
template<typename Range, typename T>
bool all_of_equal ( const Range &r, const T &val )
{
return boost::algorithm::all_of_equal ( boost::begin (r), boost::end (r), val );
}
}} // namespace boost and algorithm
#endif // BOOST_ALGORITHM_ALL_OF_HPP

View File

@@ -0,0 +1,89 @@
/*
Copyright (c) Marshall Clow 2008-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
For more information, see http://www.boost.org
*/
/// \file
/// \brief Test ranges to see if any elements match a value or predicate.
/// \author Marshall Clow
#ifndef BOOST_ALGORITHM_ANY_OF_HPP
#define BOOST_ALGORITHM_ANY_OF_HPP
#include <boost/range/begin.hpp>
#include <boost/range/end.hpp>
namespace boost { namespace algorithm {
// Use the C++11 versions of any_of if it is available
#if __cplusplus >= 201103L
using std::any_of; // Section 25.2.2
#else
/// \fn any_of ( InputIterator first, InputIterator last, Predicate p )
/// \return true if any of the elements in [first, last) satisfy the predicate
/// \note returns false on an empty range
///
/// \param first The start of the input sequence
/// \param last One past the end of the input sequence
/// \param p A predicate for testing the elements of the sequence
///
template<typename InputIterator, typename Predicate>
bool any_of ( InputIterator first, InputIterator last, Predicate p )
{
for ( ; first != last; ++first )
if ( p(*first))
return true;
return false;
}
#endif
/// \fn any_of ( const Range &r, Predicate p )
/// \return true if any elements in the range satisfy the predicate 'p'
/// \note returns false on an empty range
///
/// \param r The input range
/// \param p A predicate for testing the elements of the range
///
template<typename Range, typename Predicate>
bool any_of ( const Range &r, Predicate p )
{
return boost::algorithm::any_of (boost::begin (r), boost::end (r), p);
}
/// \fn any_of_equal ( InputIterator first, InputIterator last, const V &val )
/// \return true if any of the elements in [first, last) are equal to 'val'
/// \note returns false on an empty range
///
/// \param first The start of the input sequence
/// \param last One past the end of the input sequence
/// \param val A value to compare against
///
template<typename InputIterator, typename V>
bool any_of_equal ( InputIterator first, InputIterator last, const V &val )
{
for ( ; first != last; ++first )
if ( val == *first )
return true;
return false;
}
/// \fn any_of_equal ( const Range &r, const V &val )
/// \return true if any of the elements in the range are equal to 'val'
/// \note returns false on an empty range
///
/// \param r The input range
/// \param val A value to compare against
///
template<typename Range, typename V>
bool any_of_equal ( const Range &r, const V &val )
{
return boost::algorithm::any_of_equal (boost::begin (r), boost::end (r), val);
}
}} // namespace boost and algorithm
#endif // BOOST_ALGORITHM_ANY_OF_HPP

View File

@@ -0,0 +1,133 @@
/*
Copyright (c) Marshall Clow 2008-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
*/
/// \file copy_if.hpp
/// \brief Copy a subset of a sequence to a new sequence
/// \author Marshall Clow
#ifndef BOOST_ALGORITHM_COPY_IF_HPP
#define BOOST_ALGORITHM_COPY_IF_HPP
#include <algorithm> // for std::copy_if, if available
#include <boost/range/begin.hpp>
#include <boost/range/end.hpp>
namespace boost { namespace algorithm {
#if __cplusplus >= 201103L
// Use the C++11 versions of copy_if if it is available
using std::copy_if; // Section 25.3.1
#else
/// \fn copy_if ( InputIterator first, InputIterator last, OutputIterator result, Predicate p )
/// \brief Copies all the elements from the input range that satisfy the
/// predicate to the output range.
/// \return The updated output iterator
///
/// \param first The start of the input sequence
/// \param last One past the end of the input sequence
/// \param result An output iterator to write the results into
/// \param p A predicate for testing the elements of the range
/// \note This function is part of the C++2011 standard library.
/// We will use the standard one if it is available,
/// otherwise we have our own implementation.
template<typename InputIterator, typename OutputIterator, typename Predicate>
OutputIterator copy_if ( InputIterator first, InputIterator last, OutputIterator result, Predicate p )
{
for ( ; first != last; ++first )
if (p(*first))
*result++ = first;
return result;
}
#endif
/// \fn copy_if ( const Range &r, OutputIterator result, Predicate p )
/// \brief Copies all the elements from the input range that satisfy the
/// predicate to the output range.
/// \return The updated output iterator
///
/// \param r The input range
/// \param result An output iterator to write the results into
/// \param p A predicate for testing the elements of the range
///
template<typename Range, typename OutputIterator, typename Predicate>
OutputIterator copy_if ( const Range &r, OutputIterator result, Predicate p )
{
return boost::algorithm::copy_if (boost::begin (r), boost::end(r), result, p);
}
/// \fn copy_while ( InputIterator first, InputIterator last, OutputIterator result, Predicate p )
/// \brief Copies all the elements at the start of the input range that
/// satisfy the predicate to the output range.
/// \return The updated output iterator
///
/// \param first The start of the input sequence
/// \param last One past the end of the input sequence
/// \param result An output iterator to write the results into
/// \param p A predicate for testing the elements of the range
///
template<typename InputIterator, typename OutputIterator, typename Predicate>
OutputIterator copy_while ( InputIterator first, InputIterator last,
OutputIterator result, Predicate p )
{
for ( ; first != last && p(*first); ++first )
*result++ = first;
return result;
}
/// \fn copy_while ( const Range &r, OutputIterator result, Predicate p )
/// \brief Copies all the elements at the start of the input range that
/// satisfy the predicate to the output range.
/// \return The updated output iterator
///
/// \param r The input range
/// \param result An output iterator to write the results into
/// \param p A predicate for testing the elements of the range
///
template<typename Range, typename OutputIterator, typename Predicate>
OutputIterator copy_while ( const Range &r, OutputIterator result, Predicate p )
{
return boost::algorithm::copy_while (boost::begin (r), boost::end(r), result, p);
}
/// \fn copy_until ( InputIterator first, InputIterator last, OutputIterator result, Predicate p )
/// \brief Copies all the elements at the start of the input range that do not
/// satisfy the predicate to the output range.
/// \return The updated output iterator
///
/// \param first The start of the input sequence
/// \param last One past the end of the input sequence
/// \param result An output iterator to write the results into
/// \param p A predicate for testing the elements of the range
///
template<typename InputIterator, typename OutputIterator, typename Predicate>
OutputIterator copy_until ( InputIterator first, InputIterator last, OutputIterator result, Predicate p )
{
for ( ; first != last && !p(*first); ++first )
*result++ = first;
return result;
}
/// \fn copy_until ( const Range &r, OutputIterator result, Predicate p )
/// \brief Copies all the elements at the start of the input range that do not
/// satisfy the predicate to the output range.
/// \return The updated output iterator
///
/// \param r The input range
/// \param result An output iterator to write the results into
/// \param p A predicate for testing the elements of the range
///
template<typename Range, typename OutputIterator, typename Predicate>
OutputIterator copy_until ( const Range &r, OutputIterator result, Predicate p )
{
return boost::algorithm::copy_until (boost::begin (r), boost::end(r), result, p);
}
}} // namespace boost and algorithm
#endif // BOOST_ALGORITHM_COPY_IF_HPP

View File

@@ -0,0 +1,44 @@
/*
Copyright (c) Marshall Clow 2011-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
*/
/// \file copy_n.hpp
/// \brief Copy n items from one sequence to another
/// \author Marshall Clow
#ifndef BOOST_ALGORITHM_COPY_N_HPP
#define BOOST_ALGORITHM_COPY_N_HPP
#include <algorithm> // for std::copy_n, if available
namespace boost { namespace algorithm {
#if __cplusplus >= 201103L
// Use the C++11 versions of copy_n if it is available
using std::copy_n; // Section 25.3.1
#else
/// \fn copy_n ( InputIterator first, Size n, OutputIterator result )
/// \brief Copies exactly n (n > 0) elements from the range starting at first to
/// the range starting at result.
/// \return The updated output iterator
///
/// \param first The start of the input sequence
/// \param n The number of elements to copy
/// \param result An output iterator to write the results into
/// \note This function is part of the C++2011 standard library.
/// We will use the standard one if it is available,
/// otherwise we have our own implementation.
template <typename InputIterator, typename Size, typename OutputIterator>
OutputIterator copy_n ( InputIterator first, Size n, OutputIterator result )
{
for ( ; n > 0; --n, ++first, ++result )
*result = *first;
return result;
}
#endif
}} // namespace boost and algorithm
#endif // BOOST_ALGORITHM_COPY_IF_HPP

View File

@@ -0,0 +1,60 @@
/*
Copyright (c) Marshall Clow 2011-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
*/
/// \file find_if_not.hpp
/// \brief Find the first element in a sequence that does not satisfy a predicate.
/// \author Marshall Clow
#ifndef BOOST_ALGORITHM_FIND_IF_NOT_HPP
#define BOOST_ALGORITHM_FIND_IF_NOT_HPP
#include <algorithm> // for std::find_if_not, if it exists
#include <boost/range/begin.hpp>
#include <boost/range/end.hpp>
namespace boost { namespace algorithm {
#if __cplusplus >= 201103L
// Use the C++11 versions of find_if_not if it is available
using std::find_if_not; // Section 25.2.5
#else
/// \fn find_if_not(InputIterator first, InputIterator last, Predicate p)
/// \brief Finds the first element in the sequence that does not satisfy the predicate.
/// \return The iterator pointing to the desired element.
///
/// \param first The start of the input sequence
/// \param last One past the end of the input sequence
/// \param p A predicate for testing the elements of the range
/// \note This function is part of the C++2011 standard library.
/// We will use the standard one if it is available,
/// otherwise we have our own implementation.
template<typename InputIterator, typename Predicate>
InputIterator find_if_not ( InputIterator first, InputIterator last, Predicate p )
{
for ( ; first != last; ++first )
if ( !p(*first))
break;
return first;
}
#endif
/// \fn find_if_not ( const Range &r, Predicate p )
/// \brief Finds the first element in the sequence that does not satisfy the predicate.
/// \return The iterator pointing to the desired element.
///
/// \param r The input range
/// \param p A predicate for testing the elements of the range
///
template<typename Range, typename Predicate>
typename boost::range_iterator<const Range>::type find_if_not ( const Range &r, Predicate p )
{
return boost::algorithm::find_if_not (boost::begin (r), boost::end(r), p);
}
}}
#endif // BOOST_ALGORITHM_FIND_IF_NOT_HPP

View File

@@ -0,0 +1,74 @@
/*
Copyright (c) Marshall Clow 2008-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
*/
/// \file iota.hpp
/// \brief Generate an increasing series
/// \author Marshall Clow
#ifndef BOOST_ALGORITHM_IOTA_HPP
#define BOOST_ALGORITHM_IOTA_HPP
#include <numeric>
#include <boost/range/begin.hpp>
#include <boost/range/end.hpp>
namespace boost { namespace algorithm {
#if __cplusplus >= 201103L
// Use the C++11 versions of iota if it is available
using std::iota; // Section 26.7.6
#else
/// \fn iota ( ForwardIterator first, ForwardIterator last, T value )
/// \brief Generates an increasing sequence of values, and stores them in [first, last)
///
/// \param first The start of the input sequence
/// \param last One past the end of the input sequence
/// \param value The initial value of the sequence to be generated
/// \note This function is part of the C++2011 standard library.
/// We will use the standard one if it is available,
/// otherwise we have our own implementation.
template <typename ForwardIterator, typename T>
void iota ( ForwardIterator first, ForwardIterator last, T value )
{
for ( ; first != last; ++first, ++value )
*first = value;
}
#endif
/// \fn iota ( Range &r, T value )
/// \brief Generates an increasing sequence of values, and stores them in the input Range.
///
/// \param r The input range
/// \param value The initial value of the sequence to be generated
///
template <typename Range, typename T>
void iota ( Range &r, T value )
{
boost::algorithm::iota (boost::begin(r), boost::end(r), value);
}
/// \fn iota_n ( OutputIterator out, T value, std::size_t n )
/// \brief Generates an increasing sequence of values, and stores them in the input Range.
///
/// \param out An output iterator to write the results into
/// \param value The initial value of the sequence to be generated
/// \param n The number of items to write
///
template <typename OutputIterator, typename T>
OutputIterator iota_n ( OutputIterator out, T value, std::size_t n )
{
while ( n-- > 0 )
*out++ = value++;
return out;
}
}}
#endif // BOOST_ALGORITHM_IOTA_HPP

View File

@@ -0,0 +1,65 @@
/*
Copyright (c) Marshall Clow 2011-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
*/
/// \file is_partitioned.hpp
/// \brief Tell if a sequence is partitioned
/// \author Marshall Clow
#ifndef BOOST_ALGORITHM_IS_PARTITIONED_HPP
#define BOOST_ALGORITHM_IS_PARTITIONED_HPP
#include <algorithm> // for std::is_partitioned, if available
#include <boost/range/begin.hpp>
#include <boost/range/end.hpp>
namespace boost { namespace algorithm {
#if __cplusplus >= 201103L
// Use the C++11 versions of iota if it is available
using std::is_partitioned; // Section 25.3.13
#else
/// \fn is_partitioned ( InputIterator first, InputIterator last, UnaryPredicate p )
/// \brief Tests to see if a sequence is partititioned according to a predicate
///
/// \param first The start of the input sequence
/// \param last One past the end of the input sequence
/// \param p The predicicate to test the values with
/// \note This function is part of the C++2011 standard library.
/// We will use the standard one if it is available,
/// otherwise we have our own implementation.
template <typename InputIterator, typename UnaryPredicate>
bool is_partitioned ( InputIterator first, InputIterator last, UnaryPredicate p )
{
// Run through the part that satisfy the predicate
for ( ; first != last; ++first )
if ( !p (*first))
break;
// Now the part that does not satisfy the predicate
for ( ; first != last; ++first )
if ( p (*first))
return false;
return true;
}
#endif
/// \fn is_partitioned ( const Range &r, UnaryPredicate p )
/// \brief Generates an increasing sequence of values, and stores them in the input Range.
///
/// \param r The input range
/// \param p The predicicate to test the values with
///
template <typename Range, typename UnaryPredicate>
bool is_partitioned ( const Range &r, UnaryPredicate p )
{
return boost::algorithm::is_partitioned (boost::begin(r), boost::end(r), p);
}
}}
#endif // BOOST_ALGORITHM_IS_PARTITIONED_HPP

View File

@@ -0,0 +1,139 @@
/*
Copyright (c) Marshall Clow 2011-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
*/
/// \file is_permutation.hpp
/// \brief Is a sequence a permutation of another sequence
/// \author Marshall Clow
#ifndef BOOST_ALGORITHM_IS_PERMUTATION_HPP
#define BOOST_ALGORITHM_IS_PERMUTATION_HPP
#include <algorithm> // for std::less, tie, mismatch and is_permutation (if available)
#include <utility> // for std::make_pair
#include <functional> // for std::equal_to
#include <iterator>
#include <boost/range/begin.hpp>
#include <boost/range/end.hpp>
#include <boost/utility/enable_if.hpp>
#include <boost/type_traits/is_same.hpp>
#include <boost/tr1/tr1/tuple> // for tie
namespace boost { namespace algorithm {
#if __cplusplus >= 201103L
// Use the C++11 versions of is_permutation if it is available
using std::is_permutation; // Section 25.2.12
#else
/// \cond DOXYGEN_HIDE
namespace detail {
template <typename Predicate, typename Iterator>
struct value_predicate {
value_predicate ( Predicate p, Iterator it ) : p_ ( p ), it_ ( it ) {}
template <typename T1>
bool operator () ( const T1 &t1 ) const { return p_ ( *it_, t1 ); }
private:
Predicate &p_;
Iterator it_;
};
}
/// \endcond
/// \fn is_permutation ( ForwardIterator1 first, ForwardIterator1 last, ForwardIterator2 first2, BinaryPredicate p )
/// \brief Tests to see if a the sequence [first,last) is a permutation of the sequence starting at first2
///
/// \param first The start of the input sequence
/// \param last One past the end of the input sequence
/// \param first2 The start of the second sequence
/// \param p The predicate to compare elements with
///
/// \note This function is part of the C++2011 standard library.
/// We will use the standard one if it is available,
/// otherwise we have our own implementation.
template< class ForwardIterator1, class ForwardIterator2, class BinaryPredicate >
bool is_permutation ( ForwardIterator1 first1, ForwardIterator1 last1,
ForwardIterator2 first2, BinaryPredicate p )
{
// Skip the common prefix (if any)
// std::tie (first1, first2) = std::mismatch (first1, last1, first2, p);
std::pair<ForwardIterator1, ForwardIterator2> eq = std::mismatch (first1, last1, first2, p);
first1 = eq.first;
first2 = eq.second;
if ( first1 != last1 ) {
// Create last2
ForwardIterator2 last2 = first2;
std::advance ( last2, std::distance (first1, last1));
// for each unique value in the sequence [first1,last1), count how many times
// it occurs, and make sure it occurs the same number of times in [first2, last2)
for ( ForwardIterator1 iter = first1; iter != last1; ++iter ) {
detail::value_predicate<BinaryPredicate, ForwardIterator1> pred ( p, iter );
/* For each value we haven't seen yet... */
if ( std::find_if ( first1, iter, pred ) == iter ) {
std::size_t dest_count = std::count_if ( first2, last2, pred );
if ( dest_count == 0 || dest_count != (std::size_t) std::count_if ( iter, last1, pred ))
return false;
}
}
}
return true;
}
/// \fn is_permutation ( ForwardIterator1 first, ForwardIterator1 last, ForwardIterator2 first2 )
/// \brief Tests to see if a the sequence [first,last) is a permutation of the sequence starting at first2
///
/// \param first The start of the input sequence
/// \param last One past the end of the input sequence
/// \param first2 The start of the second sequence
/// \note This function is part of the C++2011 standard library.
/// We will use the standard one if it is available,
/// otherwise we have our own implementation.
template< class ForwardIterator1, class ForwardIterator2 >
bool is_permutation ( ForwardIterator1 first, ForwardIterator1 last, ForwardIterator2 first2 )
{
// How should I deal with the idea that ForwardIterator1::value_type
// and ForwardIterator2::value_type could be different? Define my own comparison predicate?
return boost::algorithm::is_permutation ( first, last, first2,
std::equal_to<typename std::iterator_traits<ForwardIterator1>::value_type> ());
}
#endif
/// \fn is_permutation ( const Range &r, ForwardIterator first2 )
/// \brief Tests to see if a the sequence [first,last) is a permutation of the sequence starting at first2
///
/// \param r The input range
/// \param first2 The start of the second sequence
template <typename Range, typename ForwardIterator>
bool is_permutation ( const Range &r, ForwardIterator first2 )
{
return boost::algorithm::is_permutation (boost::begin (r), boost::end (r), first2 );
}
/// \fn is_permutation ( const Range &r, ForwardIterator first2, BinaryPredicate pred )
/// \brief Tests to see if a the sequence [first,last) is a permutation of the sequence starting at first2
///
/// \param r The input range
/// \param first2 The start of the second sequence
/// \param pred The predicate to compare elements with
///
// Disable this template when the first two parameters are the same type
// That way the non-range version will be chosen.
template <typename Range, typename ForwardIterator, typename BinaryPredicate>
typename boost::disable_if_c<boost::is_same<Range, ForwardIterator>::value, bool>::type
is_permutation ( const Range &r, ForwardIterator first2, BinaryPredicate pred )
{
return boost::algorithm::is_permutation (boost::begin (r), boost::end (r), first2, pred );
}
}}
#endif // BOOST_ALGORITHM_IS_PERMUTATION_HPP

View File

@@ -0,0 +1,87 @@
/*
Copyright (c) Marshall Clow 2008-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
*/
/// \file none_of.hpp
/// \brief Test ranges to see if no elements match a value or predicate.
/// \author Marshall Clow
#ifndef BOOST_ALGORITHM_NONE_OF_HPP
#define BOOST_ALGORITHM_NONE_OF_HPP
#include <boost/range/begin.hpp>
#include <boost/range/end.hpp>
namespace boost { namespace algorithm {
// Use the C++11 versions of the none_of if it is available
#if __cplusplus >= 201103L
using std::none_of; // Section 25.2.3
#else
/// \fn none_of ( InputIterator first, InputIterator last, Predicate p )
/// \return true if none of the elements in [first, last) satisfy the predicate 'p'
/// \note returns true on an empty range
///
/// \param first The start of the input sequence
/// \param last One past the end of the input sequence
/// \param p A predicate for testing the elements of the sequence
///
template<typename InputIterator, typename Predicate>
bool none_of ( InputIterator first, InputIterator last, Predicate p )
{
for ( ; first != last; ++first )
if ( p(*first))
return false;
return true;
}
#endif
/// \fn none_of ( const Range &r, Predicate p )
/// \return true if none of the elements in the range satisfy the predicate 'p'
/// \note returns true on an empty range
///
/// \param r The input range
/// \param p A predicate for testing the elements of the range
///
template<typename Range, typename Predicate>
bool none_of ( const Range &r, Predicate p )
{
return boost::algorithm::none_of (boost::begin (r), boost::end (r), p );
}
/// \fn none_of_equal ( InputIterator first, InputIterator last, const V &val )
/// \return true if none of the elements in [first, last) are equal to 'val'
/// \note returns true on an empty range
///
/// \param first The start of the input sequence
/// \param last One past the end of the input sequence
/// \param val A value to compare against
///
template<typename InputIterator, typename V>
bool none_of_equal ( InputIterator first, InputIterator last, const V &val )
{
for ( ; first != last; ++first )
if ( val == *first )
return false;
return true;
}
/// \fn none_of_equal ( const Range &r, const V &val )
/// \return true if none of the elements in the range are equal to 'val'
/// \note returns true on an empty range
///
/// \param r The input range
/// \param val A value to compare against
///
template<typename Range, typename V>
bool none_of_equal ( const Range &r, const V & val )
{
return boost::algorithm::none_of_equal (boost::begin (r), boost::end (r), val);
}
}} // namespace boost and algorithm
#endif // BOOST_ALGORITHM_NONE_OF_HPP

View File

@@ -0,0 +1,82 @@
/*
Copyright (c) Marshall Clow 2008-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
*/
/// \file one_of.hpp
/// \brief Test ranges to see if only one element matches a value or predicate.
/// \author Marshall Clow
#ifndef BOOST_ALGORITHM_ONE_OF_HPP
#define BOOST_ALGORITHM_ONE_OF_HPP
#include <algorithm> // for std::find and std::find_if
#include <boost/algorithm/cxx11/none_of.hpp>
#include <boost/range/begin.hpp>
#include <boost/range/end.hpp>
namespace boost { namespace algorithm {
/// \fn one_of ( InputIterator first, InputIterator last, Predicate p )
/// \return true if the predicate 'p' is true for exactly one item in [first, last).
///
/// \param first The start of the input sequence
/// \param last One past the end of the input sequence
/// \param p A predicate for testing the elements of the sequence
///
template<typename InputIterator, typename Predicate>
bool one_of ( InputIterator first, InputIterator last, Predicate p )
{
InputIterator i = std::find_if (first, last, p);
if (i == last)
return false; // Didn't occur at all
return boost::algorithm::none_of (++i, last, p);
}
/// \fn one_of ( const Range &r, Predicate p )
/// \return true if the predicate 'p' is true for exactly one item in the range.
///
/// \param r The input range
/// \param p A predicate for testing the elements of the range
///
template<typename Range, typename Predicate>
bool one_of ( const Range &r, Predicate p )
{
return boost::algorithm::one_of ( boost::begin (r), boost::end (r), p );
}
/// \fn one_of_equal ( InputIterator first, InputIterator last, const V &val )
/// \return true if the value 'val' exists only once in [first, last).
///
/// \param first The start of the input sequence
/// \param last One past the end of the input sequence
/// \param val A value to compare against
///
template<typename InputIterator, typename V>
bool one_of_equal ( InputIterator first, InputIterator last, const V &val )
{
InputIterator i = std::find (first, last, val); // find first occurrence of 'val'
if (i == last)
return false; // Didn't occur at all
return boost::algorithm::none_of_equal (++i, last, val);
}
/// \fn one_of_equal ( const Range &r, const V &val )
/// \return true if the value 'val' exists only once in the range.
///
/// \param r The input range
/// \param val A value to compare against
///
template<typename Range, typename V>
bool one_of_equal ( const Range &r, const V &val )
{
return boost::algorithm::one_of_equal ( boost::begin (r), boost::end (r), val );
}
}} // namespace boost and algorithm
#endif // BOOST_ALGORITHM_ALL_HPP

View File

@@ -0,0 +1,286 @@
// Copyright (c) 2010 Nuovation System Designs, LLC
// Grant Erickson <gerickson@nuovations.com>
//
// Reworked somewhat by Marshall Clow; August 2010
//
// Distributed under the Boost Software License, Version 1.0. (See
// accompanying file LICENSE_1_0.txt or copy at
// http://www.boost.org/LICENSE_1_0.txt)
//
// See http://www.boost.org/ for latest version.
//
#ifndef BOOST_ALGORITHM_ORDERED_HPP
#define BOOST_ALGORITHM_ORDERED_HPP
#include <algorithm>
#include <functional>
#include <iterator>
#include <boost/range/begin.hpp>
#include <boost/range/end.hpp>
#include <boost/utility/enable_if.hpp>
#include <boost/type_traits/is_same.hpp>
namespace boost { namespace algorithm {
#if __cplusplus >= 201103L
// Use the C++11 versions of iota if it is available
using std::is_sorted_until; // Section 25.4.1.5
using std::is_sorted; // Section 25.4.1.5
#else
/// \fn is_sorted_until ( ForwardIterator first, ForwardIterator last, Pred p )
/// \return the point in the sequence [first, last) where the elements are unordered
/// (according to the comparison predicate 'p').
///
/// \param first The start of the sequence to be tested.
/// \param last One past the end of the sequence
/// \param p A binary predicate that returns true if two elements are ordered.
///
template <typename ForwardIterator, typename Pred>
ForwardIterator is_sorted_until ( ForwardIterator first, ForwardIterator last, Pred p )
{
if ( first == last ) return last; // the empty sequence is ordered
ForwardIterator next = first;
while ( ++next != last )
{
if ( !p ( *first, *next ))
return next;
first = next;
}
return last;
}
/// \fn is_sorted_until ( ForwardIterator first, ForwardIterator last )
/// \return the point in the sequence [first, last) where the elements are unordered
///
/// \param first The start of the sequence to be tested.
/// \param last One past the end of the sequence
///
template <typename ForwardIterator>
ForwardIterator is_sorted_until ( ForwardIterator first, ForwardIterator last )
{
typedef typename std::iterator_traits<ForwardIterator>::value_type value_type;
return boost::algorithm::is_sorted_until ( first, last, std::less_equal<value_type>());
}
/// \fn is_sorted ( ForwardIterator first, ForwardIterator last, Pred p )
/// \return whether or not the entire sequence is sorted
///
/// \param first The start of the sequence to be tested.
/// \param last One past the end of the sequence
/// \param p A binary predicate that returns true if two elements are ordered.
///
template <typename ForwardIterator, typename Pred>
bool is_sorted ( ForwardIterator first, ForwardIterator last, Pred p )
{
return boost::algorithm::is_sorted_until (first, last, p) == last;
}
/// \fn is_sorted ( ForwardIterator first, ForwardIterator last )
/// \return whether or not the entire sequence is sorted
///
/// \param first The start of the sequence to be tested.
/// \param last One past the end of the sequence
///
template <typename ForwardIterator>
bool is_sorted ( ForwardIterator first, ForwardIterator last )
{
return boost::algorithm::is_sorted_until (first, last) == last;
}
#endif
///
/// -- Range based versions of the C++11 functions
///
/// \fn is_sorted_until ( const R &range, Pred p )
/// \return the point in the range R where the elements are unordered
/// (according to the comparison predicate 'p').
///
/// \param range The range to be tested.
/// \param p A binary predicate that returns true if two elements are ordered.
///
template <typename R, typename Pred>
typename boost::lazy_disable_if_c<
boost::is_same<R, Pred>::value,
typename boost::range_iterator<const R>
>::type is_sorted_until ( const R &range, Pred p )
{
return boost::algorithm::is_sorted_until ( boost::begin ( range ), boost::end ( range ), p );
}
/// \fn is_sorted_until ( const R &range )
/// \return the point in the range R where the elements are unordered
///
/// \param range The range to be tested.
///
template <typename R>
typename boost::range_iterator<const R>::type is_sorted_until ( const R &range )
{
return boost::algorithm::is_sorted_until ( boost::begin ( range ), boost::end ( range ));
}
/// \fn is_sorted ( const R &range, Pred p )
/// \return whether or not the entire range R is sorted
/// (according to the comparison predicate 'p').
///
/// \param range The range to be tested.
/// \param p A binary predicate that returns true if two elements are ordered.
///
template <typename R, typename Pred>
bool is_sorted ( const R &range, Pred p )
{
return boost::algorithm::is_sorted ( boost::begin ( range ), boost::end ( range ), p );
}
/// \fn is_sorted ( const R &range )
/// \return whether or not the entire range R is sorted
///
/// \param range The range to be tested.
///
template <typename R, typename Pred>
bool is_sorted ( const R &range )
{
return boost::algorithm::is_sorted ( boost::begin ( range ), boost::end ( range ));
}
///
/// -- Range based versions of the C++11 functions
///
/// \fn is_increasing ( ForwardIterator first, ForwardIterator last )
/// \return true if the entire sequence is increasing; i.e, each item is greater than or
/// equal to the previous one.
///
/// \param first The start of the sequence to be tested.
/// \param last One past the end of the sequence
///
/// \note This function will return true for sequences that contain items that compare
/// equal. If that is not what you intended, you should use is_strictly_increasing instead.
template <typename ForwardIterator>
bool is_increasing ( ForwardIterator first, ForwardIterator last )
{
typedef typename std::iterator_traits<ForwardIterator>::value_type value_type;
return boost::algorithm::is_sorted (first, last, std::less_equal<value_type>());
}
/// \fn is_increasing ( const R &range )
/// \return true if the entire sequence is increasing; i.e, each item is greater than or
/// equal to the previous one.
///
/// \param range The range to be tested.
///
/// \note This function will return true for sequences that contain items that compare
/// equal. If that is not what you intended, you should use is_strictly_increasing instead.
template <typename R>
bool is_increasing ( const R &range )
{
return is_increasing ( boost::begin ( range ), boost::end ( range ));
}
/// \fn is_decreasing ( ForwardIterator first, ForwardIterator last )
/// \return true if the entire sequence is decreasing; i.e, each item is less than
/// or equal to the previous one.
///
/// \param first The start of the sequence to be tested.
/// \param last One past the end of the sequence
///
/// \note This function will return true for sequences that contain items that compare
/// equal. If that is not what you intended, you should use is_strictly_decreasing instead.
template <typename ForwardIterator>
bool is_decreasing ( ForwardIterator first, ForwardIterator last )
{
typedef typename std::iterator_traits<ForwardIterator>::value_type value_type;
return boost::algorithm::is_sorted (first, last, std::greater_equal<value_type>());
}
/// \fn is_decreasing ( const R &range )
/// \return true if the entire sequence is decreasing; i.e, each item is less than
/// or equal to the previous one.
///
/// \param range The range to be tested.
///
/// \note This function will return true for sequences that contain items that compare
/// equal. If that is not what you intended, you should use is_strictly_decreasing instead.
template <typename R>
bool is_decreasing ( const R &range )
{
return is_decreasing ( boost::begin ( range ), boost::end ( range ));
}
/// \fn is_strictly_increasing ( ForwardIterator first, ForwardIterator last )
/// \return true if the entire sequence is strictly increasing; i.e, each item is greater
/// than the previous one
///
/// \param first The start of the sequence to be tested.
/// \param last One past the end of the sequence
///
/// \note This function will return false for sequences that contain items that compare
/// equal. If that is not what you intended, you should use is_increasing instead.
template <typename ForwardIterator>
bool is_strictly_increasing ( ForwardIterator first, ForwardIterator last )
{
typedef typename std::iterator_traits<ForwardIterator>::value_type value_type;
return boost::algorithm::is_sorted (first, last, std::less<value_type>());
}
/// \fn is_strictly_increasing ( const R &range )
/// \return true if the entire sequence is strictly increasing; i.e, each item is greater
/// than the previous one
///
/// \param range The range to be tested.
///
/// \note This function will return false for sequences that contain items that compare
/// equal. If that is not what you intended, you should use is_increasing instead.
template <typename R>
bool is_strictly_increasing ( const R &range )
{
return is_strictly_increasing ( boost::begin ( range ), boost::end ( range ));
}
/// \fn is_strictly_decreasing ( ForwardIterator first, ForwardIterator last )
/// \return true if the entire sequence is strictly decreasing; i.e, each item is less than
/// the previous one
///
/// \param first The start of the sequence to be tested.
/// \param last One past the end of the sequence
///
/// \note This function will return false for sequences that contain items that compare
/// equal. If that is not what you intended, you should use is_decreasing instead.
template <typename ForwardIterator>
bool is_strictly_decreasing ( ForwardIterator first, ForwardIterator last )
{
typedef typename std::iterator_traits<ForwardIterator>::value_type value_type;
return boost::algorithm::is_sorted (first, last, std::greater<value_type>());
}
/// \fn is_strictly_decreasing ( const R &range )
/// \return true if the entire sequence is strictly decreasing; i.e, each item is less than
/// the previous one
///
/// \param range The range to be tested.
///
/// \note This function will return false for sequences that contain items that compare
/// equal. If that is not what you intended, you should use is_decreasing instead.
template <typename R>
bool is_strictly_decreasing ( const R &range )
{
return is_strictly_decreasing ( boost::begin ( range ), boost::end ( range ));
}
}} // namespace boost
#endif // BOOST_ALGORITHM_ORDERED_HPP

View File

@@ -0,0 +1,77 @@
/*
Copyright (c) Marshall Clow 2011-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
*/
/// \file partition_copy.hpp
/// \brief Copy a subset of a sequence to a new sequence
/// \author Marshall Clow
#ifndef BOOST_ALGORITHM_PARTITION_COPY_HPP
#define BOOST_ALGORITHM_PARTITION_COPY_HPP
#include <utility> // for make_pair
#include <boost/range/begin.hpp>
#include <boost/range/end.hpp>
namespace boost { namespace algorithm {
#if __cplusplus >= 201103L
// Use the C++11 versions of partition_copy if it is available
using std::partition_copy; // Section 25.3.13
#else
/// \fn partition_copy ( InputIterator first, InputIterator last,
/// OutputIterator1 out_true, OutputIterator2 out_false, UnaryPredicate p )
/// \brief Copies the elements that satisfy the predicate p from the range [first, last)
/// to the range beginning at d_first_true, and
/// copies the elements that do not satisfy p to the range beginning at d_first_false.
///
///
/// \param first The start of the input sequence
/// \param last One past the end of the input sequence
/// \param out_true An output iterator to write the elements that satisfy the predicate into
/// \param out_false An output iterator to write the elements that do not satisfy the predicate into
/// \param p A predicate for dividing the elements of the input sequence.
///
/// \note This function is part of the C++2011 standard library.
/// We will use the standard one if it is available,
/// otherwise we have our own implementation.
template <typename InputIterator,
typename OutputIterator1, typename OutputIterator2, typename UnaryPredicate>
std::pair<OutputIterator1, OutputIterator2>
partition_copy ( InputIterator first, InputIterator last,
OutputIterator1 out_true, OutputIterator2 out_false, UnaryPredicate p )
{
for ( ; first != last; ++first )
if ( p (*first))
*out_true++ = *first;
else
*out_false++ = *first;
return std::pair<OutputIterator1, OutputIterator2> ( out_true, out_false );
}
#endif
/// \fn partition_copy ( const Range &r,
/// OutputIterator1 out_true, OutputIterator2 out_false, UnaryPredicate p )
///
/// \param r The input range
/// \param out_true An output iterator to write the elements that satisfy the predicate into
/// \param out_false An output iterator to write the elements that do not satisfy the predicate into
/// \param p A predicate for dividing the elements of the input sequence.
///
template <typename Range, typename OutputIterator1, typename OutputIterator2,
typename UnaryPredicate>
std::pair<OutputIterator1, OutputIterator2>
partition_copy ( const Range &r, OutputIterator1 out_true, OutputIterator2 out_false,
UnaryPredicate p )
{
return boost::algorithm::partition_copy
(boost::begin(r), boost::end(r), out_true, out_false, p );
}
}} // namespace boost and algorithm
#endif // BOOST_ALGORITHM_PARTITION_COPY_HPP

View File

@@ -0,0 +1,72 @@
/*
Copyright (c) Marshall Clow 2011-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
*/
/// \file partition_point.hpp
/// \brief Find the partition point in a sequence
/// \author Marshall Clow
#ifndef BOOST_ALGORITHM_PARTITION_POINT_HPP
#define BOOST_ALGORITHM_PARTITION_POINT_HPP
#include <algorithm> // for std::partition_point, if available
#include <boost/range/begin.hpp>
#include <boost/range/end.hpp>
namespace boost { namespace algorithm {
#if __cplusplus >= 201103L
// Use the C++11 versions of iota if it is available
using std::partition_point; // Section 25.3.13
#else
/// \fn partition_point ( ForwardIterator first, ForwardIterator last, Predicate p )
/// \brief Given a partitioned range, returns the partition point, i.e, the first element
/// that does not satisfy p
///
/// \param first The start of the input sequence
/// \param last One past the end of the input sequence
/// \param p The predicate to test the values with
/// \note This function is part of the C++2011 standard library.
/// We will use the standard one if it is available,
/// otherwise we have our own implementation.
template <typename ForwardIterator, typename Predicate>
ForwardIterator partition_point ( ForwardIterator first, ForwardIterator last, Predicate p )
{
std::size_t dist = std::distance ( first, last );
while ( first != last ) {
std::size_t d2 = dist / 2;
ForwardIterator ret_val = first;
std::advance (ret_val, d2);
if (p (*ret_val)) {
first = ++ret_val;
dist -= d2 + 1;
}
else {
last = ret_val;
dist = d2;
}
}
return first;
}
#endif
/// \fn partition_point ( Range &r, Predicate p )
/// \brief Given a partitioned range, returns the partition point
///
/// \param r The input range
/// \param p The predicate to test the values with
///
template <typename Range, typename Predicate>
typename boost::range_iterator<Range> partition_point ( Range &r, Predicate p )
{
return boost::algorithm::partition_point (boost::begin(r), boost::end(r), p);
}
}}
#endif // BOOST_ALGORITHM_PARTITION_POINT_HPP

View File

@@ -0,0 +1,268 @@
/*
Copyright (c) Marshall Clow 2010-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
For more information, see http://www.boost.org
*/
#ifndef BOOST_ALGORITHM_BOYER_MOORE_SEARCH_HPP
#define BOOST_ALGORITHM_BOYER_MOORE_SEARCH_HPP
#include <iterator> // for std::iterator_traits
#include <boost/assert.hpp>
#include <boost/static_assert.hpp>
#include <boost/range/begin.hpp>
#include <boost/range/end.hpp>
#include <boost/utility/enable_if.hpp>
#include <boost/type_traits/is_same.hpp>
#include <boost/algorithm/searching/detail/bm_traits.hpp>
#include <boost/algorithm/searching/detail/debugging.hpp>
namespace boost { namespace algorithm {
/*
A templated version of the boyer-moore searching algorithm.
References:
http://www.cs.utexas.edu/users/moore/best-ideas/string-searching/
http://www.cs.utexas.edu/~moore/publications/fstrpos.pdf
Explanations: boostinspect:noascii (test tool complains)
http://en.wikipedia.org/wiki/BoyerMoore_string_search_algorithm
http://www.movsd.com/bm.htm
http://www.cs.ucdavis.edu/~gusfield/cs224f09/bnotes.pdf
The Boyer-Moore search algorithm uses two tables, a "bad character" table
to tell how far to skip ahead when it hits a character that is not in the pattern,
and a "good character" table to tell how far to skip ahead when it hits a
mismatch on a character that _is_ in the pattern.
Requirements:
* Random access iterators
* The two iterator types (patIter and corpusIter) must
"point to" the same underlying type and be comparable.
* Additional requirements may be imposed but the skip table, such as:
** Numeric type (array-based skip table)
** Hashable type (map-based skip table)
*/
template <typename patIter, typename traits = detail::BM_traits<patIter> >
class boyer_moore {
typedef typename std::iterator_traits<patIter>::difference_type difference_type;
public:
boyer_moore ( patIter first, patIter last )
: pat_first ( first ), pat_last ( last ),
k_pattern_length ( std::distance ( pat_first, pat_last )),
skip_ ( k_pattern_length, -1 ),
suffix_ ( k_pattern_length + 1 )
{
this->build_skip_table ( first, last );
this->build_suffix_table ( first, last );
}
~boyer_moore () {}
/// \fn operator ( corpusIter corpus_first, corpusIter corpus_last )
/// \brief Searches the corpus for the pattern that was passed into the constructor
///
/// \param corpus_first The start of the data to search (Random Access Iterator)
/// \param corpus_last One past the end of the data to search
///
template <typename corpusIter>
corpusIter operator () ( corpusIter corpus_first, corpusIter corpus_last ) const {
BOOST_STATIC_ASSERT (( boost::is_same<
typename std::iterator_traits<patIter>::value_type,
typename std::iterator_traits<corpusIter>::value_type>::value ));
if ( corpus_first == corpus_last ) return corpus_last; // if nothing to search, we didn't find it!
if ( pat_first == pat_last ) return corpus_first; // empty pattern matches at start
const difference_type k_corpus_length = std::distance ( corpus_first, corpus_last );
// If the pattern is larger than the corpus, we can't find it!
if ( k_corpus_length < k_pattern_length )
return corpus_last;
// Do the search
return this->do_search ( corpus_first, corpus_last );
}
template <typename Range>
typename boost::range_iterator<Range>::type operator () ( Range &r ) const {
return (*this) (boost::begin(r), boost::end(r));
}
private:
/// \cond DOXYGEN_HIDE
patIter pat_first, pat_last;
const difference_type k_pattern_length;
typename traits::skip_table_t skip_;
std::vector <difference_type> suffix_;
/// \fn operator ( corpusIter corpus_first, corpusIter corpus_last, Pred p )
/// \brief Searches the corpus for the pattern that was passed into the constructor
///
/// \param corpus_first The start of the data to search (Random Access Iterator)
/// \param corpus_last One past the end of the data to search
/// \param p A predicate used for the search comparisons.
///
template <typename corpusIter>
corpusIter do_search ( corpusIter corpus_first, corpusIter corpus_last ) const {
/* ---- Do the matching ---- */
corpusIter curPos = corpus_first;
const corpusIter lastPos = corpus_last - k_pattern_length;
difference_type j, k, m;
while ( curPos <= lastPos ) {
/* while ( std::distance ( curPos, corpus_last ) >= k_pattern_length ) { */
// Do we match right where we are?
j = k_pattern_length;
while ( pat_first [j-1] == curPos [j-1] ) {
j--;
// We matched - we're done!
if ( j == 0 )
return curPos;
}
// Since we didn't match, figure out how far to skip forward
k = skip_ [ curPos [ j - 1 ]];
m = j - k - 1;
if ( k < j && m > suffix_ [ j ] )
curPos += m;
else
curPos += suffix_ [ j ];
}
return corpus_last; // We didn't find anything
}
void build_skip_table ( patIter first, patIter last ) {
for ( std::size_t i = 0; first != last; ++first, ++i )
skip_.insert ( *first, i );
}
template<typename Iter, typename Container>
void compute_bm_prefix ( Iter pat_first, Iter pat_last, Container &prefix ) {
const std::size_t count = std::distance ( pat_first, pat_last );
BOOST_ASSERT ( count > 0 );
BOOST_ASSERT ( prefix.size () == count );
prefix[0] = 0;
std::size_t k = 0;
for ( std::size_t i = 1; i < count; ++i ) {
BOOST_ASSERT ( k < count );
while ( k > 0 && ( pat_first[k] != pat_first[i] )) {
BOOST_ASSERT ( k < count );
k = prefix [ k - 1 ];
}
if ( pat_first[k] == pat_first[i] )
k++;
prefix [ i ] = k;
}
}
void build_suffix_table ( patIter pat_first, patIter pat_last ) {
const std::size_t count = (std::size_t) std::distance ( pat_first, pat_last );
if ( count > 0 ) { // empty pattern
std::vector<typename std::iterator_traits<patIter>::value_type> reversed(count);
(void) std::reverse_copy ( pat_first, pat_last, reversed.begin ());
std::vector<difference_type> prefix (count);
compute_bm_prefix ( pat_first, pat_last, prefix );
std::vector<difference_type> prefix_reversed (count);
compute_bm_prefix ( reversed.begin (), reversed.end (), prefix_reversed );
for ( std::size_t i = 0; i <= count; i++ )
suffix_[i] = count - prefix [count-1];
for ( std::size_t i = 0; i < count; i++ ) {
const std::size_t j = count - prefix_reversed[i];
const difference_type k = i - prefix_reversed[i] + 1;
if (suffix_[j] > k)
suffix_[j] = k;
}
}
}
/// \endcond
};
/* Two ranges as inputs gives us four possibilities; with 2,3,3,4 parameters
Use a bit of TMP to disambiguate the 3-argument templates */
/// \fn boyer_moore_search ( corpusIter corpus_first, corpusIter corpus_last,
/// patIter pat_first, patIter pat_last )
/// \brief Searches the corpus for the pattern.
///
/// \param corpus_first The start of the data to search (Random Access Iterator)
/// \param corpus_last One past the end of the data to search
/// \param pat_first The start of the pattern to search for (Random Access Iterator)
/// \param pat_last One past the end of the data to search for
///
template <typename patIter, typename corpusIter>
corpusIter boyer_moore_search (
corpusIter corpus_first, corpusIter corpus_last,
patIter pat_first, patIter pat_last )
{
boyer_moore<patIter> bm ( pat_first, pat_last );
return bm ( corpus_first, corpus_last );
}
template <typename PatternRange, typename corpusIter>
corpusIter boyer_moore_search (
corpusIter corpus_first, corpusIter corpus_last, const PatternRange &pattern )
{
typedef typename boost::range_iterator<PatternRange> pattern_iterator;
boyer_moore<pattern_iterator> bm ( boost::begin(pattern), boost::end (pattern));
return bm ( corpus_first, corpus_last );
}
template <typename patIter, typename CorpusRange>
typename boost::lazy_disable_if_c<
boost::is_same<CorpusRange, patIter>::value, typename boost::range_iterator<CorpusRange> >
::type
boyer_moore_search ( CorpusRange &corpus, patIter pat_first, patIter pat_last )
{
boyer_moore<patIter> bm ( pat_first, pat_last );
return bm (boost::begin (corpus), boost::end (corpus));
}
template <typename PatternRange, typename CorpusRange>
typename boost::range_iterator<CorpusRange>::type
boyer_moore_search ( CorpusRange &corpus, const PatternRange &pattern )
{
typedef typename boost::range_iterator<PatternRange> pattern_iterator;
boyer_moore<pattern_iterator> bm ( boost::begin(pattern), boost::end (pattern));
return bm (boost::begin (corpus), boost::end (corpus));
}
// Creator functions -- take a pattern range, return an object
template <typename Range>
boost::algorithm::boyer_moore<typename boost::range_iterator<const Range>::type>
make_boyer_moore ( const Range &r ) {
return boost::algorithm::boyer_moore
<typename boost::range_iterator<const Range>::type> (boost::begin(r), boost::end(r));
}
template <typename Range>
boost::algorithm::boyer_moore<typename boost::range_iterator<Range>::type>
make_boyer_moore ( Range &r ) {
return boost::algorithm::boyer_moore
<typename boost::range_iterator<Range>::type> (boost::begin(r), boost::end(r));
}
}}
#endif // BOOST_ALGORITHM_BOYER_MOORE_SEARCH_HPP

View File

@@ -0,0 +1,141 @@
/*
Copyright (c) Marshall Clow 2010-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
For more information, see http://www.boost.org
*/
#ifndef BOOST_ALGORITHM_BOYER_MOORE_HORSPOOOL_SEARCH_HPP
#define BOOST_ALGORITHM_BOYER_MOORE_HORSPOOOL_SEARCH_HPP
#include <iterator> // for std::iterator_traits
#include <boost/assert.hpp>
#include <boost/static_assert.hpp>
#include <boost/type_traits/is_same.hpp>
#include <boost/algorithm/searching/detail/bm_traits.hpp>
#include <boost/algorithm/searching/detail/debugging.hpp>
// #define BOOST_ALGORITHM_BOYER_MOORE_HORSPOOL_DEBUG_HPP
namespace boost { namespace algorithm {
/*
A templated version of the boyer-moore-horspool searching algorithm.
Requirements:
* Random access iterators
* The two iterator types (patIter and corpusIter) must
"point to" the same underlying type.
* Additional requirements may be imposed buy the skip table, such as:
** Numeric type (array-based skip table)
** Hashable type (map-based skip table)
http://www-igm.univ-mlv.fr/%7Elecroq/string/node18.html
*/
template <typename patIter, typename traits = detail::BM_traits<patIter> >
class boyer_moore_horspool {
typedef typename std::iterator_traits<patIter>::difference_type difference_type;
public:
boyer_moore_horspool ( patIter first, patIter last )
: pat_first ( first ), pat_last ( last ),
k_pattern_length ( std::distance ( pat_first, pat_last )),
skip_ ( k_pattern_length, k_pattern_length ) {
// Build the skip table
std::size_t i = 0;
if ( first != last ) // empty pattern?
for ( patIter iter = first; iter != last-1; ++iter, ++i )
skip_.insert ( *iter, k_pattern_length - 1 - i );
#ifdef BOOST_ALGORITHM_BOYER_MOORE_HORSPOOL_DEBUG_HPP
skip_.PrintSkipTable ();
#endif
}
~boyer_moore_horspool () {}
/// \fn operator ( corpusIter corpus_first, corpusIter corpus_last, Pred p )
/// \brief Searches the corpus for the pattern that was passed into the constructor
///
/// \param corpus_first The start of the data to search (Random Access Iterator)
/// \param corpus_last One past the end of the data to search
/// \param p A predicate used for the search comparisons.
///
template <typename corpusIter>
corpusIter operator () ( corpusIter corpus_first, corpusIter corpus_last ) const {
BOOST_STATIC_ASSERT (( boost::is_same<
typename std::iterator_traits<patIter>::value_type,
typename std::iterator_traits<corpusIter>::value_type>::value ));
if ( corpus_first == corpus_last ) return corpus_last; // if nothing to search, we didn't find it!
if ( pat_first == pat_last ) return corpus_first; // empty pattern matches at start
const difference_type k_corpus_length = std::distance ( corpus_first, corpus_last );
// If the pattern is larger than the corpus, we can't find it!
if ( k_corpus_length < k_pattern_length )
return corpus_last;
// Do the search
return this->do_search ( corpus_first, corpus_last );
}
private:
/// \cond DOXYGEN_HIDE
patIter pat_first, pat_last;
const difference_type k_pattern_length;
typename traits::skip_table_t skip_;
/// \fn do_search ( corpusIter corpus_first, corpusIter corpus_last )
/// \brief Searches the corpus for the pattern that was passed into the constructor
///
/// \param corpus_first The start of the data to search (Random Access Iterator)
/// \param corpus_last One past the end of the data to search
/// \param k_corpus_length The length of the corpus to search
///
template <typename corpusIter>
corpusIter do_search ( corpusIter corpus_first, corpusIter corpus_last ) const {
corpusIter curPos = corpus_first;
const corpusIter lastPos = corpus_last - k_pattern_length;
while ( curPos <= lastPos ) {
// Do we match right where we are?
std::size_t j = k_pattern_length - 1;
while ( pat_first [j] == curPos [j] ) {
// We matched - we're done!
if ( j == 0 )
return curPos;
j--;
}
curPos += skip_ [ curPos [ k_pattern_length - 1 ]];
}
return corpus_last;
}
// \endcond
};
/// \fn boyer_moore_horspool_search ( corpusIter corpus_first, corpusIter corpus_last,
/// patIter pat_first, patIter pat_last )
/// \brief Searches the corpus for the pattern.
///
/// \param corpus_first The start of the data to search (Random Access Iterator)
/// \param corpus_last One past the end of the data to search
/// \param pat_first The start of the pattern to search for (Random Access Iterator)
/// \param pat_last One past the end of the data to search for
///
template <typename patIter, typename corpusIter>
corpusIter boyer_moore_horspool_search (
corpusIter corpus_first, corpusIter corpus_last,
patIter pat_first, patIter pat_last ) {
boyer_moore_horspool<patIter> bmh ( pat_first, pat_last );
return bmh ( corpus_first, corpus_last );
}
}}
#endif // BOOST_ALGORITHM_BOYER_MOORE_HORSPOOOL_SEARCH_HPP

View File

@@ -0,0 +1,105 @@
/*
Copyright (c) Marshall Clow 2010-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
For more information, see http://www.boost.org
*/
#ifndef BOOST_ALGORITHM_SEARCH_DETAIL_BM_TRAITS_HPP
#define BOOST_ALGORITHM_SEARCH_DETAIL_BM_TRAITS_HPP
#include <climits> // for CHAR_BIT
#include <vector>
#include <iterator> // for std::iterator_traits
#include <boost/type_traits/make_unsigned.hpp>
#include <boost/type_traits/is_integral.hpp>
#include <boost/type_traits/remove_pointer.hpp>
#include <boost/type_traits/remove_const.hpp>
#include <boost/array.hpp>
#include <boost/tr1/tr1/unordered_map>
#include <boost/algorithm/searching/detail/debugging.hpp>
namespace boost { namespace algorithm { namespace detail {
//
// Default implementations of the skip tables for B-M and B-M-H
//
template<typename key_type, typename value_type, bool /*useArray*/> class skip_table;
// General case for data searching other than bytes; use a map
template<typename key_type, typename value_type>
class skip_table<key_type, value_type, false> {
private:
typedef std::tr1::unordered_map<key_type, value_type> skip_map;
const value_type k_default_value;
skip_map skip_;
public:
skip_table ( std::size_t patSize, value_type default_value )
: k_default_value ( default_value ), skip_ ( patSize ) {}
void insert ( key_type key, value_type val ) {
skip_ [ key ] = val; // Would skip_.insert (val) be better here?
}
value_type operator [] ( key_type key ) const {
typename skip_map::const_iterator it = skip_.find ( key );
return it == skip_.end () ? k_default_value : it->second;
}
void PrintSkipTable () const {
std::cout << "BM(H) Skip Table <unordered_map>:" << std::endl;
for ( typename skip_map::const_iterator it = skip_.begin (); it != skip_.end (); ++it )
if ( it->second != k_default_value )
std::cout << " " << it->first << ": " << it->second << std::endl;
std::cout << std::endl;
}
};
// Special case small numeric values; use an array
template<typename key_type, typename value_type>
class skip_table<key_type, value_type, true> {
private:
typedef typename boost::make_unsigned<key_type>::type unsigned_key_type;
typedef boost::array<value_type, 1U << (CHAR_BIT * sizeof(key_type))> skip_map;
skip_map skip_;
const value_type k_default_value;
public:
skip_table ( std::size_t patSize, value_type default_value ) : k_default_value ( default_value ) {
std::fill_n ( skip_.begin(), skip_.size(), default_value );
}
void insert ( key_type key, value_type val ) {
skip_ [ static_cast<unsigned_key_type> ( key ) ] = val;
}
value_type operator [] ( key_type key ) const {
return skip_ [ static_cast<unsigned_key_type> ( key ) ];
}
void PrintSkipTable () const {
std::cout << "BM(H) Skip Table <boost:array>:" << std::endl;
for ( typename skip_map::const_iterator it = skip_.begin (); it != skip_.end (); ++it )
if ( *it != k_default_value )
std::cout << " " << std::distance (skip_.begin (), it) << ": " << *it << std::endl;
std::cout << std::endl;
}
};
template<typename Iterator>
struct BM_traits {
typedef typename std::iterator_traits<Iterator>::difference_type value_type;
typedef typename std::iterator_traits<Iterator>::value_type key_type;
typedef boost::algorithm::detail::skip_table<key_type, value_type,
boost::is_integral<key_type>::value && (sizeof(key_type)==1)> skip_table_t;
};
}}} // namespaces
#endif // BOOST_ALGORITHM_SEARCH_DETAIL_BM_TRAITS_HPP

View File

@@ -0,0 +1,30 @@
/*
Copyright (c) Marshall Clow 2010-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
For more information, see http://www.boost.org
*/
#ifndef BOOST_ALGORITHM_SEARCH_DETAIL_DEBUG_HPP
#define BOOST_ALGORITHM_SEARCH_DETAIL_DEBUG_HPP
#include <iostream>
/// \cond DOXYGEN_HIDE
namespace boost { namespace algorithm { namespace detail {
// Debugging support
template <typename Iter>
void PrintTable ( Iter first, Iter last ) {
std::cout << std::distance ( first, last ) << ": { ";
for ( Iter iter = first; iter != last; ++iter )
std::cout << *iter << " ";
std::cout << "}" << std::endl;
}
}}}
/// \endcond
#endif // BOOST_ALGORITHM_SEARCH_DETAIL_DEBUG_HPP

View File

@@ -0,0 +1,200 @@
/*
Copyright (c) Marshall Clow 2010-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
For more information, see http://www.boost.org
*/
#ifndef BOOST_ALGORITHM_KNUTH_MORRIS_PRATT_SEARCH_HPP
#define BOOST_ALGORITHM_KNUTH_MORRIS_PRATT_SEARCH_HPP
#include <vector>
#include <iterator> // for std::iterator_traits
#include <boost/assert.hpp>
#include <boost/static_assert.hpp>
#include <boost/type_traits/is_same.hpp>
#include <boost/algorithm/searching/detail/debugging.hpp>
// #define BOOST_ALGORITHM_KNUTH_MORRIS_PRATT_DEBUG
namespace boost { namespace algorithm {
// #define NEW_KMP
/*
A templated version of the Knuth-Morris-Pratt searching algorithm.
Requirements:
* Random-access iterators
* The two iterator types (I1 and I2) must "point to" the same underlying type.
http://en.wikipedia.org/wiki/KnuthMorrisPratt_algorithm
http://www.inf.fh-flensburg.de/lang/algorithmen/pattern/kmpen.htm
*/
template <typename patIter>
class knuth_morris_pratt {
typedef typename std::iterator_traits<patIter>::difference_type difference_type;
public:
knuth_morris_pratt ( patIter first, patIter last )
: pat_first ( first ), pat_last ( last ),
k_pattern_length ( std::distance ( pat_first, pat_last )),
skip_ ( k_pattern_length + 1 ) {
#ifdef NEW_KMP
preKmp ( pat_first, pat_last );
#else
init_skip_table ( pat_first, pat_last );
#endif
#ifdef BOOST_ALGORITHM_KNUTH_MORRIS_PRATT_DEBUG
detail::PrintTable ( skip_.begin (), skip_.end ());
#endif
}
~knuth_morris_pratt () {}
/// \fn operator ( corpusIter corpus_first, corpusIter corpus_last, Pred p )
/// \brief Searches the corpus for the pattern that was passed into the constructor
///
/// \param corpus_first The start of the data to search (Random Access Iterator)
/// \param corpus_last One past the end of the data to search
/// \param p A predicate used for the search comparisons.
///
template <typename corpusIter>
corpusIter operator () ( corpusIter corpus_first, corpusIter corpus_last ) const {
BOOST_STATIC_ASSERT (( boost::is_same<
typename std::iterator_traits<patIter>::value_type,
typename std::iterator_traits<corpusIter>::value_type>::value ));
if ( corpus_first == corpus_last ) return corpus_last; // if nothing to search, we didn't find it!
if ( pat_first == pat_last ) return corpus_first; // empty pattern matches at start
const difference_type k_corpus_length = std::distance ( corpus_first, corpus_last );
// If the pattern is larger than the corpus, we can't find it!
if ( k_corpus_length < k_pattern_length )
return corpus_last;
return do_search ( corpus_first, corpus_last, k_corpus_length );
}
private:
/// \cond DOXYGEN_HIDE
patIter pat_first, pat_last;
const difference_type k_pattern_length;
std::vector <difference_type> skip_;
/// \fn operator ( corpusIter corpus_first, corpusIter corpus_last, Pred p )
/// \brief Searches the corpus for the pattern that was passed into the constructor
///
/// \param corpus_first The start of the data to search (Random Access Iterator)
/// \param corpus_last One past the end of the data to search
/// \param p A predicate used for the search comparisons.
///
template <typename corpusIter>
corpusIter do_search ( corpusIter corpus_first, corpusIter corpus_last,
difference_type k_corpus_length ) const {
difference_type match_start = 0; // position in the corpus that we're matching
#ifdef NEW_KMP
int patternIdx = 0;
while ( match_start < k_corpus_length ) {
while ( patternIdx > -1 && pat_first[patternIdx] != corpus_first [match_start] )
patternIdx = skip_ [patternIdx]; //<--- Shifting the pattern on mismatch
patternIdx++;
match_start++; //<--- corpus is always increased by 1
if ( patternIdx >= (int) k_pattern_length )
return corpus_first + match_start - patternIdx;
}
#else
// At this point, we know:
// k_pattern_length <= k_corpus_length
// for all elements of skip, it holds -1 .. k_pattern_length
//
// In the loop, we have the following invariants
// idx is in the range 0 .. k_pattern_length
// match_start is in the range 0 .. k_corpus_length - k_pattern_length + 1
const difference_type last_match = k_corpus_length - k_pattern_length;
difference_type idx = 0; // position in the pattern we're comparing
while ( match_start <= last_match ) {
while ( pat_first [ idx ] == corpus_first [ match_start + idx ] ) {
if ( ++idx == k_pattern_length )
return corpus_first + match_start;
}
// Figure out where to start searching again
// assert ( idx - skip_ [ idx ] > 0 ); // we're always moving forward
match_start += idx - skip_ [ idx ];
idx = skip_ [ idx ] >= 0 ? skip_ [ idx ] : 0;
// assert ( idx >= 0 && idx < k_pattern_length );
}
#endif
// We didn't find anything
return corpus_last;
}
void preKmp ( patIter first, patIter last ) {
const /*std::size_t*/ int count = std::distance ( first, last );
int i, j;
i = 0;
j = skip_[0] = -1;
while (i < count) {
while (j > -1 && first[i] != first[j])
j = skip_[j];
i++;
j++;
if (first[i] == first[j])
skip_[i] = skip_[j];
else
skip_[i] = j;
}
}
void init_skip_table ( patIter first, patIter last ) {
const difference_type count = std::distance ( first, last );
int j;
skip_ [ 0 ] = -1;
for ( int i = 1; i <= count; ++i ) {
j = skip_ [ i - 1 ];
while ( j >= 0 ) {
if ( first [ j ] == first [ i - 1 ] )
break;
j = skip_ [ j ];
}
skip_ [ i ] = j + 1;
}
}
// \endcond
};
/// \fn knuth_morris_pratt_search ( corpusIter corpus_first, corpusIter corpus_last,
/// patIter pat_first, patIter pat_last )
/// \brief Searches the corpus for the pattern.
///
/// \param corpus_first The start of the data to search (Random Access Iterator)
/// \param corpus_last One past the end of the data to search
/// \param pat_first The start of the pattern to search for (Random Access Iterator)
/// \param pat_last One past the end of the data to search for
///
template <typename patIter, typename corpusIter>
corpusIter knuth_morris_pratt_search (
corpusIter corpus_first, corpusIter corpus_last,
patIter pat_first, patIter pat_last ) {
knuth_morris_pratt<patIter> kmp ( pat_first, pat_last );
return kmp ( corpus_first, corpus_last );
}
}}
#endif // BOOST_ALGORITHM_KNUTH_MORRIS_PRATT_SEARCH_HPP

View File

@@ -21,6 +21,7 @@
#include <boost/algorithm/string/predicate.hpp> #include <boost/algorithm/string/predicate.hpp>
#include <boost/algorithm/string/find.hpp> #include <boost/algorithm/string/find.hpp>
#include <boost/algorithm/string/split.hpp> #include <boost/algorithm/string/split.hpp>
#include <boost/algorithm/string/join.hpp>
#include <boost/algorithm/string/replace.hpp> #include <boost/algorithm/string/replace.hpp>
#include <boost/algorithm/string/erase.hpp> #include <boost/algorithm/string/erase.hpp>
#include <boost/algorithm/string/classification.hpp> #include <boost/algorithm/string/classification.hpp>

View File

@@ -59,7 +59,7 @@ namespace boost {
{ {
return ::boost::algorithm::detail::transform_range_copy( return ::boost::algorithm::detail::transform_range_copy(
Output, Output,
as_literal(Input), ::boost::as_literal(Input),
::boost::algorithm::detail::to_lowerF< ::boost::algorithm::detail::to_lowerF<
typename range_value<RangeT>::type >(Loc)); typename range_value<RangeT>::type >(Loc));
} }
@@ -93,7 +93,7 @@ namespace boost {
const std::locale& Loc=std::locale()) const std::locale& Loc=std::locale())
{ {
::boost::algorithm::detail::transform_range( ::boost::algorithm::detail::transform_range(
as_literal(Input), ::boost::as_literal(Input),
::boost::algorithm::detail::to_lowerF< ::boost::algorithm::detail::to_lowerF<
typename range_value<WritableRangeT>::type >(Loc)); typename range_value<WritableRangeT>::type >(Loc));
} }
@@ -124,7 +124,7 @@ namespace boost {
{ {
return ::boost::algorithm::detail::transform_range_copy( return ::boost::algorithm::detail::transform_range_copy(
Output, Output,
as_literal(Input), ::boost::as_literal(Input),
::boost::algorithm::detail::to_upperF< ::boost::algorithm::detail::to_upperF<
typename range_value<RangeT>::type >(Loc)); typename range_value<RangeT>::type >(Loc));
} }
@@ -158,7 +158,7 @@ namespace boost {
const std::locale& Loc=std::locale()) const std::locale& Loc=std::locale())
{ {
::boost::algorithm::detail::transform_range( ::boost::algorithm::detail::transform_range(
as_literal(Input), ::boost::as_literal(Input),
::boost::algorithm::detail::to_upperF< ::boost::algorithm::detail::to_upperF<
typename range_value<WritableRangeT>::type >(Loc)); typename range_value<WritableRangeT>::type >(Loc));
} }

View File

@@ -202,8 +202,8 @@ namespace boost {
BOOST_STRING_TYPENAME range_value<RangeT>::type> BOOST_STRING_TYPENAME range_value<RangeT>::type>
is_any_of( const RangeT& Set ) is_any_of( const RangeT& Set )
{ {
return detail::is_any_ofF< iterator_range<BOOST_STRING_TYPENAME range_const_iterator<RangeT>::type> lit_set(boost::as_literal(Set));
BOOST_STRING_TYPENAME range_value<RangeT>::type>(as_literal(Set)); return detail::is_any_ofF<BOOST_STRING_TYPENAME range_value<RangeT>::type>(lit_set);
} }
//! is_from_range predicate //! is_from_range predicate

View File

@@ -65,8 +65,8 @@ namespace boost {
void constraints() void constraints()
{ {
// Operation // Operation
begin((*pFo)( (*pF)(i,i) )); ::boost::begin((*pFo)( (*pF)(i,i) ));
end((*pFo)( (*pF)(i,i) )); ::boost::end((*pFo)( (*pF)(i,i) ));
} }
private: private:
IteratorT i; IteratorT i;

View File

@@ -15,30 +15,37 @@
#include <locale> #include <locale>
#include <functional> #include <functional>
#include <boost/type_traits/make_unsigned.hpp>
namespace boost { namespace boost {
namespace algorithm { namespace algorithm {
namespace detail { namespace detail {
// case conversion functors -----------------------------------------------// // case conversion functors -----------------------------------------------//
#if BOOST_WORKAROUND(BOOST_MSVC, >= 1400)
#pragma warning(push)
#pragma warning(disable:4512) //assignment operator could not be generated
#endif
// a tolower functor // a tolower functor
template<typename CharT> template<typename CharT>
struct to_lowerF : public std::unary_function<CharT, CharT> struct to_lowerF : public std::unary_function<CharT, CharT>
{ {
// Constructor // Constructor
to_lowerF( const std::locale& Loc ) : m_Loc( Loc ) {} to_lowerF( const std::locale& Loc ) : m_Loc( &Loc ) {}
// Operation // Operation
CharT operator ()( CharT Ch ) const CharT operator ()( CharT Ch ) const
{ {
#if defined(__BORLANDC__) && (__BORLANDC__ >= 0x560) && (__BORLANDC__ <= 0x564) && !defined(_USE_OLD_RW_STL) #if defined(__BORLANDC__) && (__BORLANDC__ >= 0x560) && (__BORLANDC__ <= 0x564) && !defined(_USE_OLD_RW_STL)
return std::tolower( Ch); return std::tolower( static_cast<typename boost::make_unsigned <CharT>::type> ( Ch ));
#else #else
return std::tolower<CharT>( Ch, m_Loc ); return std::tolower<CharT>( Ch, *m_Loc );
#endif #endif
} }
private: private:
const std::locale& m_Loc; const std::locale* m_Loc;
}; };
// a toupper functor // a toupper functor
@@ -46,21 +53,25 @@ namespace boost {
struct to_upperF : public std::unary_function<CharT, CharT> struct to_upperF : public std::unary_function<CharT, CharT>
{ {
// Constructor // Constructor
to_upperF( const std::locale& Loc ) : m_Loc( Loc ) {} to_upperF( const std::locale& Loc ) : m_Loc( &Loc ) {}
// Operation // Operation
CharT operator ()( CharT Ch ) const CharT operator ()( CharT Ch ) const
{ {
#if defined(__BORLANDC__) && (__BORLANDC__ >= 0x560) && (__BORLANDC__ <= 0x564) && !defined(_USE_OLD_RW_STL) #if defined(__BORLANDC__) && (__BORLANDC__ >= 0x560) && (__BORLANDC__ <= 0x564) && !defined(_USE_OLD_RW_STL)
return std::toupper( Ch); return std::toupper( static_cast<typename boost::make_unsigned <CharT>::type> ( Ch ));
#else #else
return std::toupper<CharT>( Ch, m_Loc ); return std::toupper<CharT>( Ch, *m_Loc );
#endif #endif
} }
private: private:
const std::locale& m_Loc; const std::locale* m_Loc;
}; };
#if BOOST_WORKAROUND(BOOST_MSVC, >= 1400)
#pragma warning(pop)
#endif
// algorithm implementation ------------------------------------------------------------------------- // algorithm implementation -------------------------------------------------------------------------
// Transform a range // Transform a range
@@ -71,8 +82,8 @@ namespace boost {
FunctorT Functor) FunctorT Functor)
{ {
return std::transform( return std::transform(
begin(Input), ::boost::begin(Input),
end(Input), ::boost::end(Input),
Output, Output,
Functor); Functor);
} }
@@ -84,9 +95,9 @@ namespace boost {
FunctorT Functor) FunctorT Functor)
{ {
std::transform( std::transform(
begin(Input), ::boost::begin(Input),
end(Input), ::boost::end(Input),
begin(Input), ::boost::begin(Input),
Functor); Functor);
} }
@@ -96,11 +107,11 @@ namespace boost {
FunctorT Functor) FunctorT Functor)
{ {
return SequenceT( return SequenceT(
make_transform_iterator( ::boost::make_transform_iterator(
begin(Input), ::boost::begin(Input),
Functor), Functor),
make_transform_iterator( ::boost::make_transform_iterator(
end(Input), ::boost::end(Input),
Functor)); Functor));
} }

View File

@@ -15,7 +15,6 @@
#include <algorithm> #include <algorithm>
#include <functional> #include <functional>
#include <locale> #include <locale>
#include <set>
#include <boost/range/begin.hpp> #include <boost/range/begin.hpp>
#include <boost/range/end.hpp> #include <boost/range/end.hpp>
@@ -29,17 +28,16 @@ namespace boost {
// classification functors -----------------------------------------------// // classification functors -----------------------------------------------//
// is_classified functor // is_classified functor
struct is_classifiedF : struct is_classifiedF :
public predicate_facade<is_classifiedF> public predicate_facade<is_classifiedF>
{ {
// Boost.Lambda support // Boost.ResultOf support
template <class Args> struct sig { typedef bool type; }; typedef bool result_type;
// Constructor from a locale // Constructor from a locale
is_classifiedF(std::ctype_base::mask Type, std::locale const & Loc = std::locale()) : is_classifiedF(std::ctype_base::mask Type, std::locale const & Loc = std::locale()) :
m_Type(Type), m_Locale(Loc) {} m_Type(Type), m_Locale(Loc) {}
// Operation // Operation
template<typename CharT> template<typename CharT>
bool operator()( CharT Ch ) const bool operator()( CharT Ch ) const
@@ -56,10 +54,11 @@ namespace boost {
#endif #endif
private: private:
const std::ctype_base::mask m_Type; std::ctype_base::mask m_Type;
const std::locale m_Locale; std::locale m_Locale;
}; };
// is_any_of functor // is_any_of functor
/* /*
returns true if the value is from the specified set returns true if the value is from the specified set
@@ -68,25 +67,181 @@ namespace boost {
struct is_any_ofF : struct is_any_ofF :
public predicate_facade<is_any_ofF<CharT> > public predicate_facade<is_any_ofF<CharT> >
{ {
// Boost.Lambda support private:
template <class Args> struct sig { typedef bool type; }; // set cannot operate on const value-type
typedef typename ::boost::remove_const<CharT>::type set_value_type;
public:
// Boost.ResultOf support
typedef bool result_type;
// Constructor // Constructor
template<typename RangeT> template<typename RangeT>
is_any_ofF( const RangeT& Range ) : is_any_ofF( const RangeT& Range ) : m_Size(0)
m_Set( begin(Range), end(Range) ) {} {
// Prepare storage
m_Storage.m_dynSet=0;
std::size_t Size=::boost::distance(Range);
m_Size=Size;
set_value_type* Storage=0;
if(use_fixed_storage(m_Size))
{
// Use fixed storage
Storage=&m_Storage.m_fixSet[0];
}
else
{
// Use dynamic storage
m_Storage.m_dynSet=new set_value_type[m_Size];
Storage=m_Storage.m_dynSet;
}
// Use fixed storage
::std::copy(::boost::begin(Range), ::boost::end(Range), Storage);
::std::sort(Storage, Storage+m_Size);
}
// Copy constructor
is_any_ofF(const is_any_ofF& Other) : m_Size(Other.m_Size)
{
// Prepare storage
m_Storage.m_dynSet=0;
const set_value_type* SrcStorage=0;
set_value_type* DestStorage=0;
if(use_fixed_storage(m_Size))
{
// Use fixed storage
DestStorage=&m_Storage.m_fixSet[0];
SrcStorage=&Other.m_Storage.m_fixSet[0];
}
else
{
// Use dynamic storage
m_Storage.m_dynSet=new set_value_type[m_Size];
DestStorage=m_Storage.m_dynSet;
SrcStorage=Other.m_Storage.m_dynSet;
}
// Use fixed storage
::std::memcpy(DestStorage, SrcStorage, sizeof(set_value_type)*m_Size);
}
// Destructor
~is_any_ofF()
{
if(!use_fixed_storage(m_Size) && m_Storage.m_dynSet!=0)
{
delete [] m_Storage.m_dynSet;
}
}
// Assignment
is_any_ofF& operator=(const is_any_ofF& Other)
{
// Handle self assignment
if(this==&Other) return *this;
// Prepare storage
const set_value_type* SrcStorage;
set_value_type* DestStorage;
if(use_fixed_storage(Other.m_Size))
{
// Use fixed storage
DestStorage=&m_Storage.m_fixSet[0];
SrcStorage=&Other.m_Storage.m_fixSet[0];
// Delete old storage if was present
if(!use_fixed_storage(m_Size) && m_Storage.m_dynSet!=0)
{
delete [] m_Storage.m_dynSet;
}
// Set new size
m_Size=Other.m_Size;
}
else
{
// Other uses dynamic storage
SrcStorage=Other.m_Storage.m_dynSet;
// Check what kind of storage are we using right now
if(use_fixed_storage(m_Size))
{
// Using fixed storage, allocate new
set_value_type* pTemp=new set_value_type[Other.m_Size];
DestStorage=pTemp;
m_Storage.m_dynSet=pTemp;
m_Size=Other.m_Size;
}
else
{
// Using dynamic storage, check if can reuse
if(m_Storage.m_dynSet!=0 && m_Size>=Other.m_Size && m_Size<Other.m_Size*2)
{
// Reuse the current storage
DestStorage=m_Storage.m_dynSet;
m_Size=Other.m_Size;
}
else
{
// Allocate the new one
set_value_type* pTemp=new set_value_type[Other.m_Size];
DestStorage=pTemp;
// Delete old storage if necessary
if(m_Storage.m_dynSet!=0)
{
delete [] m_Storage.m_dynSet;
}
// Store the new storage
m_Storage.m_dynSet=pTemp;
// Set new size
m_Size=Other.m_Size;
}
}
}
// Copy the data
::std::memcpy(DestStorage, SrcStorage, sizeof(set_value_type)*m_Size);
return *this;
}
// Operation // Operation
template<typename Char2T> template<typename Char2T>
bool operator()( Char2T Ch ) const bool operator()( Char2T Ch ) const
{ {
return m_Set.find(Ch)!=m_Set.end(); const set_value_type* Storage=
(use_fixed_storage(m_Size))
? &m_Storage.m_fixSet[0]
: m_Storage.m_dynSet;
return ::std::binary_search(Storage, Storage+m_Size, Ch);
}
private:
// check if the size is eligible for fixed storage
static bool use_fixed_storage(std::size_t size)
{
return size<=sizeof(set_value_type*)*2;
} }
private: private:
// set cannot operate on const value-type // storage
typedef typename remove_const<CharT>::type set_value_type; // The actual used storage is selected on the type
std::set<set_value_type> m_Set; union
{
set_value_type* m_dynSet;
set_value_type m_fixSet[sizeof(set_value_type*)*2];
}
m_Storage;
// storage size
::std::size_t m_Size;
}; };
// is_from_range functor // is_from_range functor
@@ -98,8 +253,8 @@ namespace boost {
struct is_from_rangeF : struct is_from_rangeF :
public predicate_facade< is_from_rangeF<CharT> > public predicate_facade< is_from_rangeF<CharT> >
{ {
// Boost.Lambda support // Boost.ResultOf support
template <class Args> struct sig { typedef bool type; }; typedef bool result_type;
// Constructor // Constructor
is_from_rangeF( CharT From, CharT To ) : m_From(From), m_To(To) {} is_from_rangeF( CharT From, CharT To ) : m_From(From), m_To(To) {}
@@ -123,8 +278,8 @@ namespace boost {
{ {
public: public:
// Boost.Lambda support // Boost.ResultOf support
template <class Args> struct sig { typedef bool type; }; typedef bool result_type;
// Constructor // Constructor
pred_andF( Pred1T Pred1, Pred2T Pred2 ) : pred_andF( Pred1T Pred1, Pred2T Pred2 ) :
@@ -148,8 +303,8 @@ namespace boost {
public predicate_facade< pred_orF<Pred1T,Pred2T> > public predicate_facade< pred_orF<Pred1T,Pred2T> >
{ {
public: public:
// Boost.Lambda support // Boost.ResultOf support
template <class Args> struct sig { typedef bool type; }; typedef bool result_type;
// Constructor // Constructor
pred_orF( Pred1T Pred1, Pred2T Pred2 ) : pred_orF( Pred1T Pred1, Pred2T Pred2 ) :
@@ -173,8 +328,8 @@ namespace boost {
public predicate_facade< pred_notF<PredT> > public predicate_facade< pred_notF<PredT> >
{ {
public: public:
// Boost.Lambda support // Boost.ResultOf support
template <class Args> struct sig { typedef bool type; }; typedef bool result_type;
// Constructor // Constructor
pred_notF( PredT Pred ) : m_Pred(Pred) {} pred_notF( PredT Pred ) : m_Pred(Pred) {}

View File

@@ -24,26 +24,7 @@ namespace boost {
// find_format_copy (iterator variant) implementation -------------------------------// // find_format_copy (iterator variant) implementation -------------------------------//
template< template<
typename OutputIteratorT,
typename InputT,
typename FormatterT,
typename FindResultT >
inline OutputIteratorT find_format_copy_impl(
OutputIteratorT Output,
const InputT& Input,
FormatterT Formatter,
const FindResultT& FindResult )
{
return find_format_copy_impl2(
Output,
Input,
Formatter,
FindResult,
Formatter(FindResult) );
}
template<
typename OutputIteratorT, typename OutputIteratorT,
typename InputT, typename InputT,
typename FormatterT, typename FormatterT,
@@ -68,40 +49,48 @@ namespace boost {
if ( !M ) if ( !M )
{ {
// Match not found - return original sequence // Match not found - return original sequence
std::copy( begin(Input), end(Input), Output ); Output = std::copy( ::boost::begin(Input), ::boost::end(Input), Output );
return Output; return Output;
} }
// Copy the beginning of the sequence // Copy the beginning of the sequence
std::copy( begin(Input), begin(M), Output ); Output = std::copy( ::boost::begin(Input), ::boost::begin(M), Output );
// Format find result // Format find result
// Copy formated result // Copy formated result
std::copy( begin(M.format_result()), end(M.format_result()), Output ); Output = std::copy( ::boost::begin(M.format_result()), ::boost::end(M.format_result()), Output );
// Copy the rest of the sequence // Copy the rest of the sequence
std::copy( M.end(), end(Input), Output ); Output = std::copy( M.end(), ::boost::end(Input), Output );
return Output; return Output;
} }
// find_format_copy implementation --------------------------------------------------//
template< template<
typename InputT, typename OutputIteratorT,
typename InputT,
typename FormatterT, typename FormatterT,
typename FindResultT > typename FindResultT >
inline InputT find_format_copy_impl( inline OutputIteratorT find_format_copy_impl(
OutputIteratorT Output,
const InputT& Input, const InputT& Input,
FormatterT Formatter, FormatterT Formatter,
const FindResultT& FindResult) const FindResultT& FindResult )
{ {
return find_format_copy_impl2( if( ::boost::algorithm::detail::check_find_result(Input, FindResult) ) {
Input, return ::boost::algorithm::detail::find_format_copy_impl2(
Formatter, Output,
FindResult, Input,
Formatter(FindResult) ); Formatter,
FindResult,
Formatter(FindResult) );
} else {
return std::copy( ::boost::begin(Input), ::boost::end(Input), Output );
}
} }
template<
// find_format_copy implementation --------------------------------------------------//
template<
typename InputT, typename InputT,
typename FormatterT, typename FormatterT,
typename FindResultT, typename FindResultT,
@@ -129,33 +118,37 @@ namespace boost {
InputT Output; InputT Output;
// Copy the beginning of the sequence // Copy the beginning of the sequence
insert( Output, end(Output), begin(Input), M.begin() ); insert( Output, ::boost::end(Output), ::boost::begin(Input), M.begin() );
// Copy formated result // Copy formated result
insert( Output, end(Output), M.format_result() ); insert( Output, ::boost::end(Output), M.format_result() );
// Copy the rest of the sequence // Copy the rest of the sequence
insert( Output, end(Output), M.end(), end(Input) ); insert( Output, ::boost::end(Output), M.end(), ::boost::end(Input) );
return Output; return Output;
} }
// replace implementation ----------------------------------------------------// template<
typename InputT,
template<
typename InputT,
typename FormatterT, typename FormatterT,
typename FindResultT > typename FindResultT >
inline void find_format_impl( inline InputT find_format_copy_impl(
InputT& Input, const InputT& Input,
FormatterT Formatter, FormatterT Formatter,
const FindResultT& FindResult) const FindResultT& FindResult)
{ {
find_format_impl2( if( ::boost::algorithm::detail::check_find_result(Input, FindResult) ) {
Input, return ::boost::algorithm::detail::find_format_copy_impl2(
Formatter, Input,
FindResult, Formatter,
Formatter(FindResult) ); FindResult,
Formatter(FindResult) );
} else {
return Input;
}
} }
// replace implementation ----------------------------------------------------//
template< template<
typename InputT, typename InputT,
typename FormatterT, typename FormatterT,
@@ -183,7 +176,25 @@ namespace boost {
} }
// Replace match // Replace match
replace( Input, M.begin(), M.end(), M.format_result() ); ::boost::algorithm::detail::replace( Input, M.begin(), M.end(), M.format_result() );
}
template<
typename InputT,
typename FormatterT,
typename FindResultT >
inline void find_format_impl(
InputT& Input,
FormatterT Formatter,
const FindResultT& FindResult)
{
if( ::boost::algorithm::detail::check_find_result(Input, FindResult) ) {
::boost::algorithm::detail::find_format_impl2(
Input,
Formatter,
FindResult,
Formatter(FindResult) );
}
} }
} // namespace detail } // namespace detail

View File

@@ -24,29 +24,7 @@ namespace boost {
// find_format_all_copy (iterator variant) implementation ---------------------------// // find_format_all_copy (iterator variant) implementation ---------------------------//
template< template<
typename OutputIteratorT,
typename InputT,
typename FinderT,
typename FormatterT,
typename FindResultT >
inline OutputIteratorT find_format_all_copy_impl(
OutputIteratorT Output,
const InputT& Input,
FinderT Finder,
FormatterT Formatter,
const FindResultT& FindResult )
{
return find_format_all_copy_impl2(
Output,
Input,
Finder,
Formatter,
FindResult,
Formatter(FindResult) );
}
template<
typename OutputIteratorT, typename OutputIteratorT,
typename InputT, typename InputT,
typename FinderT, typename FinderT,
@@ -73,49 +51,56 @@ namespace boost {
store_type M( FindResult, FormatResult, Formatter ); store_type M( FindResult, FormatResult, Formatter );
// Initialize last match // Initialize last match
input_iterator_type LastMatch=begin(Input); input_iterator_type LastMatch=::boost::begin(Input);
// Iterate through all matches // Iterate through all matches
while( M ) while( M )
{ {
// Copy the beginning of the sequence // Copy the beginning of the sequence
std::copy( LastMatch, M.begin(), Output ); Output = std::copy( LastMatch, M.begin(), Output );
// Copy formated result // Copy formated result
std::copy( begin(M.format_result()), end(M.format_result()), Output ); Output = std::copy( ::boost::begin(M.format_result()), ::boost::end(M.format_result()), Output );
// Proceed to the next match // Proceed to the next match
LastMatch=M.end(); LastMatch=M.end();
M=Finder( LastMatch, end(Input) ); M=Finder( LastMatch, ::boost::end(Input) );
} }
// Copy the rest of the sequence // Copy the rest of the sequence
std::copy( LastMatch, end(Input), Output ); Output = std::copy( LastMatch, ::boost::end(Input), Output );
return Output; return Output;
} }
// find_format_all_copy implementation ----------------------------------------------//
template< template<
typename InputT, typename OutputIteratorT,
typename InputT,
typename FinderT, typename FinderT,
typename FormatterT, typename FormatterT,
typename FindResultT > typename FindResultT >
inline InputT find_format_all_copy_impl( inline OutputIteratorT find_format_all_copy_impl(
OutputIteratorT Output,
const InputT& Input, const InputT& Input,
FinderT Finder, FinderT Finder,
FormatterT Formatter, FormatterT Formatter,
const FindResultT& FindResult) const FindResultT& FindResult )
{ {
return find_format_all_copy_impl2( if( ::boost::algorithm::detail::check_find_result(Input, FindResult) ) {
Input, return ::boost::algorithm::detail::find_format_all_copy_impl2(
Finder, Output,
Formatter, Input,
FindResult, Finder,
Formatter(FindResult) ); Formatter,
FindResult,
Formatter(FindResult) );
} else {
return std::copy( ::boost::begin(Input), ::boost::end(Input), Output );
}
} }
template< // find_format_all_copy implementation ----------------------------------------------//
template<
typename InputT, typename InputT,
typename FinderT, typename FinderT,
typename FormatterT, typename FormatterT,
@@ -140,7 +125,7 @@ namespace boost {
store_type M( FindResult, FormatResult, Formatter ); store_type M( FindResult, FormatResult, Formatter );
// Initialize last match // Initialize last match
input_iterator_type LastMatch=begin(Input); input_iterator_type LastMatch=::boost::begin(Input);
// Output temporary // Output temporary
InputT Output; InputT Output;
@@ -149,42 +134,46 @@ namespace boost {
while( M ) while( M )
{ {
// Copy the beginning of the sequence // Copy the beginning of the sequence
insert( Output, end(Output), LastMatch, M.begin() ); insert( Output, ::boost::end(Output), LastMatch, M.begin() );
// Copy formated result // Copy formated result
insert( Output, end(Output), M.format_result() ); insert( Output, ::boost::end(Output), M.format_result() );
// Proceed to the next match // Proceed to the next match
LastMatch=M.end(); LastMatch=M.end();
M=Finder( LastMatch, end(Input) ); M=Finder( LastMatch, ::boost::end(Input) );
} }
// Copy the rest of the sequence // Copy the rest of the sequence
insert( Output, end(Output), LastMatch, end(Input) ); ::boost::algorithm::detail::insert( Output, ::boost::end(Output), LastMatch, ::boost::end(Input) );
return Output; return Output;
} }
// find_format_all implementation ------------------------------------------------// template<
typename InputT,
template<
typename InputT,
typename FinderT, typename FinderT,
typename FormatterT, typename FormatterT,
typename FindResultT > typename FindResultT >
inline void find_format_all_impl( inline InputT find_format_all_copy_impl(
InputT& Input, const InputT& Input,
FinderT Finder, FinderT Finder,
FormatterT Formatter, FormatterT Formatter,
FindResultT FindResult) const FindResultT& FindResult)
{ {
find_format_all_impl2( if( ::boost::algorithm::detail::check_find_result(Input, FindResult) ) {
Input, return ::boost::algorithm::detail::find_format_all_copy_impl2(
Finder, Input,
Formatter, Finder,
FindResult, Formatter,
Formatter(FindResult) ); FindResult,
Formatter(FindResult) );
} else {
return Input;
}
} }
// find_format_all implementation ------------------------------------------------//
template< template<
typename InputT, typename InputT,
typename FinderT, typename FinderT,
@@ -213,8 +202,8 @@ namespace boost {
BOOST_STRING_TYPENAME range_value<InputT>::type> Storage; BOOST_STRING_TYPENAME range_value<InputT>::type> Storage;
// Initialize replacement iterators // Initialize replacement iterators
input_iterator_type InsertIt=begin(Input); input_iterator_type InsertIt=::boost::begin(Input);
input_iterator_type SearchIt=begin(Input); input_iterator_type SearchIt=::boost::begin(Input);
while( M ) while( M )
{ {
@@ -230,29 +219,50 @@ namespace boost {
SearchIt=M.end(); SearchIt=M.end();
// Copy formated replace to the storage // Copy formated replace to the storage
copy_to_storage( Storage, M.format_result() ); ::boost::algorithm::detail::copy_to_storage( Storage, M.format_result() );
// Find range for a next match // Find range for a next match
M=Finder( SearchIt, end(Input) ); M=Finder( SearchIt, ::boost::end(Input) );
} }
// process the last segment // process the last segment
InsertIt=process_segment( InsertIt=::boost::algorithm::detail::process_segment(
Storage, Storage,
Input, Input,
InsertIt, InsertIt,
SearchIt, SearchIt,
end(Input) ); ::boost::end(Input) );
if ( Storage.empty() ) if ( Storage.empty() )
{ {
// Truncate input // Truncate input
erase( Input, InsertIt, end(Input) ); ::boost::algorithm::detail::erase( Input, InsertIt, ::boost::end(Input) );
} }
else else
{ {
// Copy remaining data to the end of input // Copy remaining data to the end of input
insert( Input, end(Input), Storage.begin(), Storage.end() ); ::boost::algorithm::detail::insert( Input, ::boost::end(Input), Storage.begin(), Storage.end() );
}
}
template<
typename InputT,
typename FinderT,
typename FormatterT,
typename FindResultT >
inline void find_format_all_impl(
InputT& Input,
FinderT Finder,
FormatterT Formatter,
FindResultT FindResult)
{
if( ::boost::algorithm::detail::check_find_result(Input, FindResult) ) {
::boost::algorithm::detail::find_format_all_impl2(
Input,
Finder,
Formatter,
FindResult,
Formatter(FindResult) );
} }
} }

View File

@@ -20,6 +20,10 @@ namespace boost {
// temporary format and find result storage --------------------------------// // temporary format and find result storage --------------------------------//
#if BOOST_WORKAROUND(BOOST_MSVC, >= 1400)
#pragma warning(push)
#pragma warning(disable:4512) //assignment operator could not be generated
#endif
template< template<
typename ForwardIteratorT, typename ForwardIteratorT,
typename FormatterT, typename FormatterT,
@@ -48,7 +52,9 @@ namespace boost {
find_format_store& operator=( FindResultT FindResult ) find_format_store& operator=( FindResultT FindResult )
{ {
iterator_range<ForwardIteratorT>::operator=(FindResult); iterator_range<ForwardIteratorT>::operator=(FindResult);
m_FormatResult=m_Formatter(FindResult); if( !this->empty() ) {
m_FormatResult=m_Formatter(FindResult);
}
return *this; return *this;
} }
@@ -64,6 +70,18 @@ namespace boost {
const formatter_type& m_Formatter; const formatter_type& m_Formatter;
}; };
template<typename InputT, typename FindResultT>
bool check_find_result(InputT&, FindResultT& FindResult)
{
typedef BOOST_STRING_TYPENAME
range_const_iterator<InputT>::type input_iterator_type;
iterator_range<input_iterator_type> ResultRange(FindResult);
return !ResultRange.empty();
}
#if BOOST_WORKAROUND(BOOST_MSVC, >= 1400)
#pragma warning(pop)
#endif
} // namespace detail } // namespace detail
} // namespace algorithm } // namespace algorithm
} // namespace boost } // namespace boost

View File

@@ -41,7 +41,7 @@ namespace boost {
// Construction // Construction
template< typename SearchT > template< typename SearchT >
first_finderF( const SearchT& Search, PredicateT Comp ) : first_finderF( const SearchT& Search, PredicateT Comp ) :
m_Search(begin(Search), end(Search)), m_Comp(Comp) {} m_Search(::boost::begin(Search), ::boost::end(Search)), m_Comp(Comp) {}
first_finderF( first_finderF(
search_iterator_type SearchBegin, search_iterator_type SearchBegin,
search_iterator_type SearchEnd, search_iterator_type SearchEnd,
@@ -108,7 +108,7 @@ namespace boost {
// Construction // Construction
template< typename SearchT > template< typename SearchT >
last_finderF( const SearchT& Search, PredicateT Comp ) : last_finderF( const SearchT& Search, PredicateT Comp ) :
m_Search(begin(Search), end(Search)), m_Comp(Comp) {} m_Search(::boost::begin(Search), ::boost::end(Search)), m_Comp(Comp) {}
last_finderF( last_finderF(
search_iterator_type SearchBegin, search_iterator_type SearchBegin,
search_iterator_type SearchEnd, search_iterator_type SearchEnd,
@@ -154,7 +154,7 @@ namespace boost {
while( M ) while( M )
{ {
Last=M; Last=M;
M=first_finder( end(M), End ); M=first_finder( ::boost::end(M), End );
} }
return Last; return Last;
@@ -224,7 +224,7 @@ namespace boost {
const SearchT& Search, const SearchT& Search,
int Nth, int Nth,
PredicateT Comp) : PredicateT Comp) :
m_Search(begin(Search), end(Search)), m_Search(::boost::begin(Search), ::boost::end(Search)),
m_Nth(Nth), m_Nth(Nth),
m_Comp(Comp) {} m_Comp(Comp) {}
nth_finderF( nth_finderF(
@@ -279,7 +279,7 @@ namespace boost {
for( unsigned int n=0; n<=N; ++n ) for( unsigned int n=0; n<=N; ++n )
{ {
// find next match // find next match
M=first_finder( end(M), End ); M=first_finder( ::boost::end(M), End );
if ( !M ) if ( !M )
{ {
@@ -314,7 +314,7 @@ namespace boost {
for( unsigned int n=1; n<=N; ++n ) for( unsigned int n=1; n<=N; ++n )
{ {
// find next match // find next match
M=last_finder( Begin, begin(M) ); M=last_finder( Begin, ::boost::begin(M) );
if ( !M ) if ( !M )
{ {
@@ -382,7 +382,7 @@ namespace boost {
typedef BOOST_STRING_TYPENAME boost::detail:: typedef BOOST_STRING_TYPENAME boost::detail::
iterator_traits<ForwardIteratorT>::iterator_category category; iterator_traits<ForwardIteratorT>::iterator_category category;
return find_head_impl( Begin, End, N, category() ); return ::boost::algorithm::detail::find_head_impl( Begin, End, N, category() );
} }
template< typename ForwardIteratorT > template< typename ForwardIteratorT >
@@ -456,7 +456,7 @@ namespace boost {
typedef BOOST_STRING_TYPENAME boost::detail:: typedef BOOST_STRING_TYPENAME boost::detail::
iterator_traits<ForwardIteratorT>::iterator_category category; iterator_traits<ForwardIteratorT>::iterator_category category;
return find_tail_impl( Begin, End, N, category() ); return ::boost::algorithm::detail::find_tail_impl( Begin, End, N, category() );
} }
@@ -484,14 +484,14 @@ namespace boost {
{ {
if(m_N>=0) if(m_N>=0)
{ {
return find_head_impl( Begin, End, m_N ); return ::boost::algorithm::detail::find_head_impl( Begin, End, m_N );
} }
else else
{ {
iterator_range<ForwardIteratorT> Res= iterator_range<ForwardIteratorT> Res=
find_tail_impl( Begin, End, -m_N ); ::boost::algorithm::detail::find_tail_impl( Begin, End, -m_N );
return make_iterator_range(Begin, Res.begin()); return ::boost::make_iterator_range(Begin, Res.begin());
} }
} }
@@ -522,14 +522,14 @@ namespace boost {
{ {
if(m_N>=0) if(m_N>=0)
{ {
return find_tail_impl( Begin, End, m_N ); return ::boost::algorithm::detail::find_tail_impl( Begin, End, m_N );
} }
else else
{ {
iterator_range<ForwardIteratorT> Res= iterator_range<ForwardIteratorT> Res=
find_head_impl( Begin, End, -m_N ); ::boost::algorithm::detail::find_head_impl( Begin, End, -m_N );
return make_iterator_range(Res.end(), End); return ::boost::make_iterator_range(Res.end(), End);
} }
} }

View File

@@ -98,7 +98,7 @@ namespace boost {
// instantiate match result // instantiate match result
match_results<input_iterator_type> result; match_results<input_iterator_type> result;
// search for a match // search for a match
if ( regex_search( Begin, End, result, m_Rx, m_MatchFlags ) ) if ( ::boost::regex_search( Begin, End, result, m_Rx, m_MatchFlags ) )
{ {
// construct a result // construct a result
return result_type( result ); return result_type( result );

View File

@@ -39,7 +39,7 @@ namespace boost {
public: public:
// Construction // Construction
const_formatF(const RangeT& Format) : const_formatF(const RangeT& Format) :
m_Format(begin(Format), end(Format)) {} m_Format(::boost::begin(Format), ::boost::end(Format)) {}
// Operation // Operation
#if BOOST_WORKAROUND(__BORLANDC__, BOOST_TESTED_AT(0x564)) #if BOOST_WORKAROUND(__BORLANDC__, BOOST_TESTED_AT(0x564))
@@ -70,7 +70,7 @@ namespace boost {
template< typename Range2T > template< typename Range2T >
const RangeT& operator()(const Range2T& Replace) const const RangeT& operator()(const Range2T& Replace) const
{ {
return RangeT(begin(Replace), end(Replace)); return RangeT(::boost::begin(Replace), ::boost::end(Replace));
} }
}; };
@@ -87,6 +87,31 @@ namespace boost {
} }
}; };
// dissect format functor ----------------------------------------------------//
// dissect format functor
template<typename FinderT>
struct dissect_formatF
{
public:
// Construction
dissect_formatF(FinderT Finder) :
m_Finder(Finder) {}
// Operation
template<typename RangeT>
inline iterator_range<
BOOST_STRING_TYPENAME range_const_iterator<RangeT>::type>
operator()(const RangeT& Replace) const
{
return m_Finder(::boost::begin(Replace), ::boost::end(Replace));
}
private:
FinderT m_Finder;
};
} // namespace detail } // namespace detail
} // namespace algorithm } // namespace algorithm
} // namespace boost } // namespace boost

View File

@@ -63,7 +63,7 @@ namespace boost {
iterator_range<ForwardIterator1T> Result iterator_range<ForwardIterator1T> Result
=last_finder( =last_finder(
make_iterator_range(SubBegin, SubEnd), ::boost::make_iterator_range(SubBegin, SubEnd),
Comp)(Begin, End); Comp)(Begin, End);
return !Result.empty() && Result.end()==End; return !Result.empty() && Result.end()==End;

View File

@@ -46,7 +46,7 @@ namespace boost {
StorageT& Storage, StorageT& Storage,
const WhatT& What ) const WhatT& What )
{ {
Storage.insert( Storage.end(), begin(What), end(What) ); Storage.insert( Storage.end(), ::boost::begin(What), ::boost::end(What) );
} }
@@ -68,7 +68,7 @@ namespace boost {
ForwardIteratorT SegmentEnd ) ForwardIteratorT SegmentEnd )
{ {
// Copy data from the storage until the beginning of the segment // Copy data from the storage until the beginning of the segment
ForwardIteratorT It=move_from_storage( Storage, InsertIt, SegmentBegin ); ForwardIteratorT It=::boost::algorithm::detail::move_from_storage( Storage, InsertIt, SegmentBegin );
// 3 cases are possible : // 3 cases are possible :
// a) Storage is empty, It==SegmentBegin // a) Storage is empty, It==SegmentBegin
@@ -125,7 +125,7 @@ namespace boost {
{ {
// Call replace to do the job // Call replace to do the job
replace( Input, InsertIt, SegmentBegin, Storage ); ::boost::algorithm::detail::replace( Input, InsertIt, SegmentBegin, Storage );
// Empty the storage // Empty the storage
Storage.clear(); Storage.clear();
// Iterators were not changed, simply return the end of segment // Iterators were not changed, simply return the end of segment

View File

@@ -41,7 +41,7 @@ namespace boost {
BOOST_STRING_TYPENAME InputT::iterator At, BOOST_STRING_TYPENAME InputT::iterator At,
const InsertT& Insert ) const InsertT& Insert )
{ {
insert( Input, At, begin(Insert), end(Insert) ); ::boost::algorithm::detail::insert( Input, At, ::boost::begin(Insert), ::boost::end(Insert) );
} }
// erase helper ---------------------------------------------------// // erase helper ---------------------------------------------------//
@@ -184,11 +184,11 @@ namespace boost {
{ {
if(From!=To) if(From!=To)
{ {
replace( Input, From, To, begin(Insert), end(Insert) ); ::boost::algorithm::detail::replace( Input, From, To, ::boost::begin(Insert), ::boost::end(Insert) );
} }
else else
{ {
insert( Input, From, begin(Insert), end(Insert) ); ::boost::algorithm::detail::insert( Input, From, ::boost::begin(Insert), ::boost::end(Insert) );
} }
} }

View File

@@ -20,36 +20,6 @@ namespace boost {
// trim iterator helper -----------------------------------------------// // trim iterator helper -----------------------------------------------//
// Search for first non matching character from the beginning of the sequence
template< typename ForwardIteratorT, typename PredicateT >
inline ForwardIteratorT trim_begin(
ForwardIteratorT InBegin,
ForwardIteratorT InEnd,
PredicateT IsSpace )
{
ForwardIteratorT It=InBegin;
for(; It!=InEnd; ++It )
{
if (!IsSpace(*It))
return It;
}
return It;
}
// Search for first non matching character from the end of the sequence
template< typename ForwardIteratorT, typename PredicateT >
inline ForwardIteratorT trim_end(
ForwardIteratorT InBegin,
ForwardIteratorT InEnd,
PredicateT IsSpace )
{
typedef BOOST_STRING_TYPENAME boost::detail::
iterator_traits<ForwardIteratorT>::iterator_category category;
return trim_end_iter_select( InBegin, InEnd, IsSpace, category() );
}
template< typename ForwardIteratorT, typename PredicateT > template< typename ForwardIteratorT, typename PredicateT >
inline ForwardIteratorT trim_end_iter_select( inline ForwardIteratorT trim_end_iter_select(
ForwardIteratorT InBegin, ForwardIteratorT InBegin,
@@ -86,6 +56,36 @@ namespace boost {
return InBegin; return InBegin;
} }
// Search for first non matching character from the beginning of the sequence
template< typename ForwardIteratorT, typename PredicateT >
inline ForwardIteratorT trim_begin(
ForwardIteratorT InBegin,
ForwardIteratorT InEnd,
PredicateT IsSpace )
{
ForwardIteratorT It=InBegin;
for(; It!=InEnd; ++It )
{
if (!IsSpace(*It))
return It;
}
return It;
}
// Search for first non matching character from the end of the sequence
template< typename ForwardIteratorT, typename PredicateT >
inline ForwardIteratorT trim_end(
ForwardIteratorT InBegin,
ForwardIteratorT InEnd,
PredicateT IsSpace )
{
typedef BOOST_STRING_TYPENAME boost::detail::
iterator_traits<ForwardIteratorT>::iterator_category category;
return ::boost::algorithm::detail::trim_end_iter_select( InBegin, InEnd, IsSpace, category() );
}
} // namespace detail } // namespace detail
} // namespace algorithm } // namespace algorithm

View File

@@ -54,11 +54,11 @@ namespace boost {
BOOST_STRING_TYPENAME BOOST_STRING_TYPENAME
range_const_iterator<RangeT>::type>& SearchRange ) range_const_iterator<RangeT>::type>& SearchRange )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Output, Output,
Input, Input,
range_finder(SearchRange), ::boost::algorithm::range_finder(SearchRange),
empty_formatter(Input) ); ::boost::algorithm::empty_formatter(Input) );
} }
//! Erase range algorithm //! Erase range algorithm
@@ -72,10 +72,10 @@ namespace boost {
BOOST_STRING_TYPENAME BOOST_STRING_TYPENAME
range_const_iterator<SequenceT>::type>& SearchRange ) range_const_iterator<SequenceT>::type>& SearchRange )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Input, Input,
range_finder(SearchRange), ::boost::algorithm::range_finder(SearchRange),
empty_formatter(Input) ); ::boost::algorithm::empty_formatter(Input) );
} }
//! Erase range algorithm //! Erase range algorithm
@@ -93,10 +93,10 @@ namespace boost {
BOOST_STRING_TYPENAME BOOST_STRING_TYPENAME
range_iterator<SequenceT>::type>& SearchRange ) range_iterator<SequenceT>::type>& SearchRange )
{ {
find_format( ::boost::algorithm::find_format(
Input, Input,
range_finder(SearchRange), ::boost::algorithm::range_finder(SearchRange),
empty_formatter(Input) ); ::boost::algorithm::empty_formatter(Input) );
} }
// erase_first --------------------------------------------------------// // erase_first --------------------------------------------------------//
@@ -124,11 +124,11 @@ namespace boost {
const Range1T& Input, const Range1T& Input,
const Range2T& Search ) const Range2T& Search )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Output, Output,
Input, Input,
first_finder(Search), ::boost::algorithm::first_finder(Search),
empty_formatter(Input) ); ::boost::algorithm::empty_formatter(Input) );
} }
//! Erase first algorithm //! Erase first algorithm
@@ -140,10 +140,10 @@ namespace boost {
const SequenceT& Input, const SequenceT& Input,
const RangeT& Search ) const RangeT& Search )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Input, Input,
first_finder(Search), ::boost::algorithm::first_finder(Search),
empty_formatter(Input) ); ::boost::algorithm::empty_formatter(Input) );
} }
//! Erase first algorithm //! Erase first algorithm
@@ -159,10 +159,10 @@ namespace boost {
SequenceT& Input, SequenceT& Input,
const RangeT& Search ) const RangeT& Search )
{ {
find_format( ::boost::algorithm::find_format(
Input, Input,
first_finder(Search), ::boost::algorithm::first_finder(Search),
empty_formatter(Input) ); ::boost::algorithm::empty_formatter(Input) );
} }
// erase_first ( case insensitive ) ------------------------------------// // erase_first ( case insensitive ) ------------------------------------//
@@ -193,11 +193,11 @@ namespace boost {
const Range2T& Search, const Range2T& Search,
const std::locale& Loc=std::locale() ) const std::locale& Loc=std::locale() )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Output, Output,
Input, Input,
first_finder(Search, is_iequal(Loc)), ::boost::algorithm::first_finder(Search, is_iequal(Loc)),
empty_formatter(Input) ); ::boost::algorithm::empty_formatter(Input) );
} }
//! Erase first algorithm ( case insensitive ) //! Erase first algorithm ( case insensitive )
@@ -210,10 +210,10 @@ namespace boost {
const RangeT& Search, const RangeT& Search,
const std::locale& Loc=std::locale() ) const std::locale& Loc=std::locale() )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Input, Input,
first_finder(Search, is_iequal(Loc)), ::boost::algorithm::first_finder(Search, is_iequal(Loc)),
empty_formatter(Input) ); ::boost::algorithm::empty_formatter(Input) );
} }
//! Erase first algorithm ( case insensitive ) //! Erase first algorithm ( case insensitive )
@@ -231,10 +231,10 @@ namespace boost {
const RangeT& Search, const RangeT& Search,
const std::locale& Loc=std::locale() ) const std::locale& Loc=std::locale() )
{ {
find_format( ::boost::algorithm::find_format(
Input, Input,
first_finder(Search, is_iequal(Loc)), ::boost::algorithm::first_finder(Search, is_iequal(Loc)),
empty_formatter(Input) ); ::boost::algorithm::empty_formatter(Input) );
} }
// erase_last --------------------------------------------------------// // erase_last --------------------------------------------------------//
@@ -262,11 +262,11 @@ namespace boost {
const Range1T& Input, const Range1T& Input,
const Range2T& Search ) const Range2T& Search )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Output, Output,
Input, Input,
last_finder(Search), ::boost::algorithm::last_finder(Search),
empty_formatter(Input) ); ::boost::algorithm::empty_formatter(Input) );
} }
//! Erase last algorithm //! Erase last algorithm
@@ -278,10 +278,10 @@ namespace boost {
const SequenceT& Input, const SequenceT& Input,
const RangeT& Search ) const RangeT& Search )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Input, Input,
last_finder(Search), ::boost::algorithm::last_finder(Search),
empty_formatter(Input) ); ::boost::algorithm::empty_formatter(Input) );
} }
//! Erase last algorithm //! Erase last algorithm
@@ -297,10 +297,10 @@ namespace boost {
SequenceT& Input, SequenceT& Input,
const RangeT& Search ) const RangeT& Search )
{ {
find_format( ::boost::algorithm::find_format(
Input, Input,
last_finder(Search), ::boost::algorithm::last_finder(Search),
empty_formatter(Input) ); ::boost::algorithm::empty_formatter(Input) );
} }
// erase_last ( case insensitive ) ------------------------------------// // erase_last ( case insensitive ) ------------------------------------//
@@ -331,11 +331,11 @@ namespace boost {
const Range2T& Search, const Range2T& Search,
const std::locale& Loc=std::locale() ) const std::locale& Loc=std::locale() )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Output, Output,
Input, Input,
last_finder(Search, is_iequal(Loc)), ::boost::algorithm::last_finder(Search, is_iequal(Loc)),
empty_formatter(Input) ); ::boost::algorithm::empty_formatter(Input) );
} }
//! Erase last algorithm ( case insensitive ) //! Erase last algorithm ( case insensitive )
@@ -348,10 +348,10 @@ namespace boost {
const RangeT& Search, const RangeT& Search,
const std::locale& Loc=std::locale() ) const std::locale& Loc=std::locale() )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Input, Input,
last_finder(Search, is_iequal(Loc)), ::boost::algorithm::last_finder(Search, is_iequal(Loc)),
empty_formatter(Input) ); ::boost::algorithm::empty_formatter(Input) );
} }
//! Erase last algorithm ( case insensitive ) //! Erase last algorithm ( case insensitive )
@@ -369,10 +369,10 @@ namespace boost {
const RangeT& Search, const RangeT& Search,
const std::locale& Loc=std::locale() ) const std::locale& Loc=std::locale() )
{ {
find_format( ::boost::algorithm::find_format(
Input, Input,
last_finder(Search, is_iequal(Loc)), ::boost::algorithm::last_finder(Search, is_iequal(Loc)),
empty_formatter(Input) ); ::boost::algorithm::empty_formatter(Input) );
} }
// erase_nth --------------------------------------------------------------------// // erase_nth --------------------------------------------------------------------//
@@ -404,11 +404,11 @@ namespace boost {
const Range2T& Search, const Range2T& Search,
int Nth ) int Nth )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Output, Output,
Input, Input,
nth_finder(Search, Nth), ::boost::algorithm::nth_finder(Search, Nth),
empty_formatter(Input) ); ::boost::algorithm::empty_formatter(Input) );
} }
//! Erase nth algorithm //! Erase nth algorithm
@@ -421,10 +421,10 @@ namespace boost {
const RangeT& Search, const RangeT& Search,
int Nth ) int Nth )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Input, Input,
nth_finder(Search, Nth), ::boost::algorithm::nth_finder(Search, Nth),
empty_formatter(Input) ); ::boost::algorithm::empty_formatter(Input) );
} }
//! Erase nth algorithm //! Erase nth algorithm
@@ -443,10 +443,10 @@ namespace boost {
const RangeT& Search, const RangeT& Search,
int Nth ) int Nth )
{ {
find_format( ::boost::algorithm::find_format(
Input, Input,
nth_finder(Search, Nth), ::boost::algorithm::nth_finder(Search, Nth),
empty_formatter(Input) ); ::boost::algorithm::empty_formatter(Input) );
} }
// erase_nth ( case insensitive ) ---------------------------------------------// // erase_nth ( case insensitive ) ---------------------------------------------//
@@ -480,11 +480,11 @@ namespace boost {
int Nth, int Nth,
const std::locale& Loc=std::locale() ) const std::locale& Loc=std::locale() )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Output, Output,
Input, Input,
nth_finder(Search, Nth, is_iequal(Loc)), ::boost::algorithm::nth_finder(Search, Nth, is_iequal(Loc)),
empty_formatter(Input) ); ::boost::algorithm::empty_formatter(Input) );
} }
//! Erase nth algorithm //! Erase nth algorithm
@@ -498,9 +498,9 @@ namespace boost {
int Nth, int Nth,
const std::locale& Loc=std::locale() ) const std::locale& Loc=std::locale() )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Input, Input,
nth_finder(Search, Nth, is_iequal(Loc)), ::boost::algorithm::nth_finder(Search, Nth, is_iequal(Loc)),
empty_formatter(Input) ); empty_formatter(Input) );
} }
@@ -522,10 +522,10 @@ namespace boost {
int Nth, int Nth,
const std::locale& Loc=std::locale() ) const std::locale& Loc=std::locale() )
{ {
find_format( ::boost::algorithm::find_format(
Input, Input,
nth_finder(Search, Nth, is_iequal(Loc)), ::boost::algorithm::nth_finder(Search, Nth, is_iequal(Loc)),
empty_formatter(Input) ); ::boost::algorithm::empty_formatter(Input) );
} }
@@ -555,11 +555,11 @@ namespace boost {
const Range1T& Input, const Range1T& Input,
const Range2T& Search ) const Range2T& Search )
{ {
return find_format_all_copy( return ::boost::algorithm::find_format_all_copy(
Output, Output,
Input, Input,
first_finder(Search), ::boost::algorithm::first_finder(Search),
empty_formatter(Input) ); ::boost::algorithm::empty_formatter(Input) );
} }
//! Erase all algorithm //! Erase all algorithm
@@ -571,10 +571,10 @@ namespace boost {
const SequenceT& Input, const SequenceT& Input,
const RangeT& Search ) const RangeT& Search )
{ {
return find_format_all_copy( return ::boost::algorithm::find_format_all_copy(
Input, Input,
first_finder(Search), ::boost::algorithm::first_finder(Search),
empty_formatter(Input) ); ::boost::algorithm::empty_formatter(Input) );
} }
//! Erase all algorithm //! Erase all algorithm
@@ -590,10 +590,10 @@ namespace boost {
SequenceT& Input, SequenceT& Input,
const RangeT& Search ) const RangeT& Search )
{ {
find_format_all( ::boost::algorithm::find_format_all(
Input, Input,
first_finder(Search), ::boost::algorithm::first_finder(Search),
empty_formatter(Input) ); ::boost::algorithm::empty_formatter(Input) );
} }
// erase_all ( case insensitive ) ------------------------------------// // erase_all ( case insensitive ) ------------------------------------//
@@ -624,11 +624,11 @@ namespace boost {
const Range2T& Search, const Range2T& Search,
const std::locale& Loc=std::locale() ) const std::locale& Loc=std::locale() )
{ {
return find_format_all_copy( return ::boost::algorithm::find_format_all_copy(
Output, Output,
Input, Input,
first_finder(Search, is_iequal(Loc)), ::boost::algorithm::first_finder(Search, is_iequal(Loc)),
empty_formatter(Input) ); ::boost::algorithm::empty_formatter(Input) );
} }
//! Erase all algorithm ( case insensitive ) //! Erase all algorithm ( case insensitive )
@@ -641,10 +641,10 @@ namespace boost {
const RangeT& Search, const RangeT& Search,
const std::locale& Loc=std::locale() ) const std::locale& Loc=std::locale() )
{ {
return find_format_all_copy( return ::boost::algorithm::find_format_all_copy(
Input, Input,
first_finder(Search, is_iequal(Loc)), ::boost::algorithm::first_finder(Search, is_iequal(Loc)),
empty_formatter(Input) ); ::boost::algorithm::empty_formatter(Input) );
} }
//! Erase all algorithm ( case insensitive ) //! Erase all algorithm ( case insensitive )
@@ -662,10 +662,10 @@ namespace boost {
const RangeT& Search, const RangeT& Search,
const std::locale& Loc=std::locale() ) const std::locale& Loc=std::locale() )
{ {
find_format_all( ::boost::algorithm::find_format_all(
Input, Input,
first_finder(Search, is_iequal(Loc)), ::boost::algorithm::first_finder(Search, is_iequal(Loc)),
empty_formatter(Input) ); ::boost::algorithm::empty_formatter(Input) );
} }
// erase_head --------------------------------------------------------------------// // erase_head --------------------------------------------------------------------//
@@ -696,11 +696,11 @@ namespace boost {
const RangeT& Input, const RangeT& Input,
int N ) int N )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Output, Output,
Input, Input,
head_finder(N), ::boost::algorithm::head_finder(N),
empty_formatter( Input ) ); ::boost::algorithm::empty_formatter( Input ) );
} }
//! Erase head algorithm //! Erase head algorithm
@@ -712,10 +712,10 @@ namespace boost {
const SequenceT& Input, const SequenceT& Input,
int N ) int N )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Input, Input,
head_finder(N), ::boost::algorithm::head_finder(N),
empty_formatter( Input ) ); ::boost::algorithm::empty_formatter( Input ) );
} }
//! Erase head algorithm //! Erase head algorithm
@@ -734,10 +734,10 @@ namespace boost {
SequenceT& Input, SequenceT& Input,
int N ) int N )
{ {
find_format( ::boost::algorithm::find_format(
Input, Input,
head_finder(N), ::boost::algorithm::head_finder(N),
empty_formatter( Input ) ); ::boost::algorithm::empty_formatter( Input ) );
} }
// erase_tail --------------------------------------------------------------------// // erase_tail --------------------------------------------------------------------//
@@ -752,7 +752,7 @@ namespace boost {
\param Output An output iterator to which the result will be copied \param Output An output iterator to which the result will be copied
\param Input An input string \param Input An input string
\param N Length of the head. \param N Length of the tail.
For N>=0, at most N characters are extracted. For N>=0, at most N characters are extracted.
For N<0, size(Input)-|N| characters are extracted. For N<0, size(Input)-|N| characters are extracted.
\return An output iterator pointing just after the last inserted character or \return An output iterator pointing just after the last inserted character or
@@ -768,11 +768,11 @@ namespace boost {
const RangeT& Input, const RangeT& Input,
int N ) int N )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Output, Output,
Input, Input,
tail_finder(N), ::boost::algorithm::tail_finder(N),
empty_formatter( Input ) ); ::boost::algorithm::empty_formatter( Input ) );
} }
//! Erase tail algorithm //! Erase tail algorithm
@@ -784,10 +784,10 @@ namespace boost {
const SequenceT& Input, const SequenceT& Input,
int N ) int N )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Input, Input,
tail_finder(N), ::boost::algorithm::tail_finder(N),
empty_formatter( Input ) ); ::boost::algorithm::empty_formatter( Input ) );
} }
//! Erase tail algorithm //! Erase tail algorithm
@@ -797,7 +797,7 @@ namespace boost {
considered to be the tail. The input sequence is modified in-place. considered to be the tail. The input sequence is modified in-place.
\param Input An input string \param Input An input string
\param N Length of the head \param N Length of the tail
For N>=0, at most N characters are extracted. For N>=0, at most N characters are extracted.
For N<0, size(Input)-|N| characters are extracted. For N<0, size(Input)-|N| characters are extracted.
*/ */
@@ -806,10 +806,10 @@ namespace boost {
SequenceT& Input, SequenceT& Input,
int N ) int N )
{ {
find_format( ::boost::algorithm::find_format(
Input, Input,
tail_finder(N), ::boost::algorithm::tail_finder(N),
empty_formatter( Input ) ); ::boost::algorithm::empty_formatter( Input ) );
} }
} // namespace algorithm } // namespace algorithm

View File

@@ -17,8 +17,6 @@
#include <boost/range/begin.hpp> #include <boost/range/begin.hpp>
#include <boost/range/end.hpp> #include <boost/range/end.hpp>
#include <boost/range/iterator.hpp> #include <boost/range/iterator.hpp>
#include <boost/range/const_iterator.hpp>
#include <boost/range/result_iterator.hpp>
#include <boost/range/as_literal.hpp> #include <boost/range/as_literal.hpp>
#include <boost/algorithm/string/finder.hpp> #include <boost/algorithm/string/finder.hpp>
@@ -50,14 +48,14 @@ namespace boost {
*/ */
template<typename RangeT, typename FinderT> template<typename RangeT, typename FinderT>
inline iterator_range< inline iterator_range<
BOOST_STRING_TYPENAME range_result_iterator<RangeT>::type> BOOST_STRING_TYPENAME range_iterator<RangeT>::type>
find( find(
RangeT& Input, RangeT& Input,
const FinderT& Finder) const FinderT& Finder)
{ {
iterator_range<BOOST_STRING_TYPENAME range_iterator<RangeT>::type> lit_input(as_literal(Input)); iterator_range<BOOST_STRING_TYPENAME range_iterator<RangeT>::type> lit_input(::boost::as_literal(Input));
return Finder(begin(lit_input),end(lit_input)); return Finder(::boost::begin(lit_input),::boost::end(lit_input));
} }
// find_first -----------------------------------------------// // find_first -----------------------------------------------//
@@ -78,12 +76,12 @@ namespace boost {
*/ */
template<typename Range1T, typename Range2T> template<typename Range1T, typename Range2T>
inline iterator_range< inline iterator_range<
BOOST_STRING_TYPENAME range_result_iterator<Range1T>::type> BOOST_STRING_TYPENAME range_iterator<Range1T>::type>
find_first( find_first(
Range1T& Input, Range1T& Input,
const Range2T& Search) const Range2T& Search)
{ {
return find(Input, first_finder(Search)); return ::boost::algorithm::find(Input, ::boost::algorithm::first_finder(Search));
} }
//! Find first algorithm ( case insensitive ) //! Find first algorithm ( case insensitive )
@@ -104,13 +102,13 @@ namespace boost {
*/ */
template<typename Range1T, typename Range2T> template<typename Range1T, typename Range2T>
inline iterator_range< inline iterator_range<
BOOST_STRING_TYPENAME range_result_iterator<Range1T>::type> BOOST_STRING_TYPENAME range_iterator<Range1T>::type>
ifind_first( ifind_first(
Range1T& Input, Range1T& Input,
const Range2T& Search, const Range2T& Search,
const std::locale& Loc=std::locale()) const std::locale& Loc=std::locale())
{ {
return find(Input, first_finder(Search,is_iequal(Loc))); return ::boost::algorithm::find(Input, ::boost::algorithm::first_finder(Search,is_iequal(Loc)));
} }
// find_last -----------------------------------------------// // find_last -----------------------------------------------//
@@ -131,12 +129,12 @@ namespace boost {
*/ */
template<typename Range1T, typename Range2T> template<typename Range1T, typename Range2T>
inline iterator_range< inline iterator_range<
BOOST_STRING_TYPENAME range_result_iterator<Range1T>::type> BOOST_STRING_TYPENAME range_iterator<Range1T>::type>
find_last( find_last(
Range1T& Input, Range1T& Input,
const Range2T& Search) const Range2T& Search)
{ {
return find(Input, last_finder(Search)); return ::boost::algorithm::find(Input, ::boost::algorithm::last_finder(Search));
} }
//! Find last algorithm ( case insensitive ) //! Find last algorithm ( case insensitive )
@@ -157,13 +155,13 @@ namespace boost {
*/ */
template<typename Range1T, typename Range2T> template<typename Range1T, typename Range2T>
inline iterator_range< inline iterator_range<
BOOST_STRING_TYPENAME range_result_iterator<Range1T>::type> BOOST_STRING_TYPENAME range_iterator<Range1T>::type>
ifind_last( ifind_last(
Range1T& Input, Range1T& Input,
const Range2T& Search, const Range2T& Search,
const std::locale& Loc=std::locale()) const std::locale& Loc=std::locale())
{ {
return find(Input, last_finder(Search, is_iequal(Loc))); return ::boost::algorithm::find(Input, ::boost::algorithm::last_finder(Search, is_iequal(Loc)));
} }
// find_nth ----------------------------------------------------------------------// // find_nth ----------------------------------------------------------------------//
@@ -185,13 +183,13 @@ namespace boost {
*/ */
template<typename Range1T, typename Range2T> template<typename Range1T, typename Range2T>
inline iterator_range< inline iterator_range<
BOOST_STRING_TYPENAME range_result_iterator<Range1T>::type> BOOST_STRING_TYPENAME range_iterator<Range1T>::type>
find_nth( find_nth(
Range1T& Input, Range1T& Input,
const Range2T& Search, const Range2T& Search,
int Nth) int Nth)
{ {
return find(Input, nth_finder(Search,Nth)); return ::boost::algorithm::find(Input, ::boost::algorithm::nth_finder(Search,Nth));
} }
//! Find n-th algorithm ( case insensitive ). //! Find n-th algorithm ( case insensitive ).
@@ -215,14 +213,14 @@ namespace boost {
*/ */
template<typename Range1T, typename Range2T> template<typename Range1T, typename Range2T>
inline iterator_range< inline iterator_range<
BOOST_STRING_TYPENAME range_result_iterator<Range1T>::type> BOOST_STRING_TYPENAME range_iterator<Range1T>::type>
ifind_nth( ifind_nth(
Range1T& Input, Range1T& Input,
const Range2T& Search, const Range2T& Search,
int Nth, int Nth,
const std::locale& Loc=std::locale()) const std::locale& Loc=std::locale())
{ {
return find(Input, nth_finder(Search,Nth,is_iequal(Loc))); return ::boost::algorithm::find(Input, ::boost::algorithm::nth_finder(Search,Nth,is_iequal(Loc)));
} }
// find_head ----------------------------------------------------------------------// // find_head ----------------------------------------------------------------------//
@@ -247,19 +245,19 @@ namespace boost {
*/ */
template<typename RangeT> template<typename RangeT>
inline iterator_range< inline iterator_range<
BOOST_STRING_TYPENAME range_result_iterator<RangeT>::type> BOOST_STRING_TYPENAME range_iterator<RangeT>::type>
find_head( find_head(
RangeT& Input, RangeT& Input,
int N) int N)
{ {
return find(Input, head_finder(N)); return ::boost::algorithm::find(Input, ::boost::algorithm::head_finder(N));
} }
// find_tail ----------------------------------------------------------------------// // find_tail ----------------------------------------------------------------------//
//! Find tail algorithm //! Find tail algorithm
/*! /*!
Get the head of the input. Head is a suffix of the string of the Get the tail of the input. Tail is a suffix of the string of the
given size. If the input is shorter then required, whole input if considered given size. If the input is shorter then required, whole input if considered
to be the tail. to be the tail.
@@ -278,12 +276,12 @@ namespace boost {
*/ */
template<typename RangeT> template<typename RangeT>
inline iterator_range< inline iterator_range<
BOOST_STRING_TYPENAME range_result_iterator<RangeT>::type> BOOST_STRING_TYPENAME range_iterator<RangeT>::type>
find_tail( find_tail(
RangeT& Input, RangeT& Input,
int N) int N)
{ {
return find(Input, tail_finder(N)); return ::boost::algorithm::find(Input, ::boost::algorithm::tail_finder(N));
} }
// find_token --------------------------------------------------------------------// // find_token --------------------------------------------------------------------//
@@ -307,13 +305,13 @@ namespace boost {
*/ */
template<typename RangeT, typename PredicateT> template<typename RangeT, typename PredicateT>
inline iterator_range< inline iterator_range<
BOOST_STRING_TYPENAME range_result_iterator<RangeT>::type> BOOST_STRING_TYPENAME range_iterator<RangeT>::type>
find_token( find_token(
RangeT& Input, RangeT& Input,
PredicateT Pred, PredicateT Pred,
token_compress_mode_type eCompress=token_compress_off) token_compress_mode_type eCompress=token_compress_off)
{ {
return find(Input, token_finder(Pred, eCompress)); return ::boost::algorithm::find(Input, ::boost::algorithm::token_finder(Pred, eCompress));
} }
} // namespace algorithm } // namespace algorithm

View File

@@ -17,6 +17,7 @@
#include <boost/range/begin.hpp> #include <boost/range/begin.hpp>
#include <boost/range/end.hpp> #include <boost/range/end.hpp>
#include <boost/range/const_iterator.hpp> #include <boost/range/const_iterator.hpp>
#include <boost/range/as_literal.hpp>
#include <boost/algorithm/string/concept.hpp> #include <boost/algorithm/string/concept.hpp>
#include <boost/algorithm/string/detail/find_format.hpp> #include <boost/algorithm/string/detail/find_format.hpp>
@@ -61,21 +62,24 @@ namespace boost {
FormatterT Formatter ) FormatterT Formatter )
{ {
// Concept check // Concept check
function_requires< BOOST_CONCEPT_ASSERT((
FinderConcept<FinderT, FinderConcept<
BOOST_STRING_TYPENAME range_const_iterator<RangeT>::type> >(); FinderT,
function_requires< BOOST_STRING_TYPENAME range_const_iterator<RangeT>::type>
));
BOOST_CONCEPT_ASSERT((
FormatterConcept< FormatterConcept<
FormatterT, FormatterT,
FinderT,BOOST_STRING_TYPENAME range_const_iterator<RangeT>::type> >(); FinderT,BOOST_STRING_TYPENAME range_const_iterator<RangeT>::type>
));
iterator_range<BOOST_STRING_TYPENAME range_const_iterator<RangeT>::type> lit_input(as_literal(Input)); iterator_range<BOOST_STRING_TYPENAME range_const_iterator<RangeT>::type> lit_input(::boost::as_literal(Input));
return detail::find_format_copy_impl( return detail::find_format_copy_impl(
Output, Output,
lit_input, lit_input,
Formatter, Formatter,
Finder( begin(lit_input), end(lit_input) ) ); Finder( ::boost::begin(lit_input), ::boost::end(lit_input) ) );
} }
//! Generic replace algorithm //! Generic replace algorithm
@@ -92,18 +96,21 @@ namespace boost {
FormatterT Formatter ) FormatterT Formatter )
{ {
// Concept check // Concept check
function_requires< BOOST_CONCEPT_ASSERT((
FinderConcept<FinderT, FinderConcept<
BOOST_STRING_TYPENAME range_const_iterator<SequenceT>::type> >(); FinderT,
function_requires< BOOST_STRING_TYPENAME range_const_iterator<SequenceT>::type>
));
BOOST_CONCEPT_ASSERT((
FormatterConcept< FormatterConcept<
FormatterT, FormatterT,
FinderT,BOOST_STRING_TYPENAME range_const_iterator<SequenceT>::type> >(); FinderT,BOOST_STRING_TYPENAME range_const_iterator<SequenceT>::type>
));
return detail::find_format_copy_impl( return detail::find_format_copy_impl(
Input, Input,
Formatter, Formatter,
Finder(begin(Input), end(Input))); Finder(::boost::begin(Input), ::boost::end(Input)));
} }
//! Generic replace algorithm //! Generic replace algorithm
@@ -125,18 +132,21 @@ namespace boost {
FormatterT Formatter) FormatterT Formatter)
{ {
// Concept check // Concept check
function_requires< BOOST_CONCEPT_ASSERT((
FinderConcept<FinderT, FinderConcept<
BOOST_STRING_TYPENAME range_const_iterator<SequenceT>::type> >(); FinderT,
function_requires< BOOST_STRING_TYPENAME range_const_iterator<SequenceT>::type>
));
BOOST_CONCEPT_ASSERT((
FormatterConcept< FormatterConcept<
FormatterT, FormatterT,
FinderT,BOOST_STRING_TYPENAME range_const_iterator<SequenceT>::type> >(); FinderT,BOOST_STRING_TYPENAME range_const_iterator<SequenceT>::type>
));
detail::find_format_impl( detail::find_format_impl(
Input, Input,
Formatter, Formatter,
Finder(begin(Input), end(Input))); Finder(::boost::begin(Input), ::boost::end(Input)));
} }
@@ -171,22 +181,25 @@ namespace boost {
FormatterT Formatter) FormatterT Formatter)
{ {
// Concept check // Concept check
function_requires< BOOST_CONCEPT_ASSERT((
FinderConcept<FinderT, FinderConcept<
BOOST_STRING_TYPENAME range_const_iterator<RangeT>::type> >(); FinderT,
function_requires< BOOST_STRING_TYPENAME range_const_iterator<RangeT>::type>
));
BOOST_CONCEPT_ASSERT((
FormatterConcept< FormatterConcept<
FormatterT, FormatterT,
FinderT,BOOST_STRING_TYPENAME range_const_iterator<RangeT>::type> >(); FinderT,BOOST_STRING_TYPENAME range_const_iterator<RangeT>::type>
));
iterator_range<BOOST_STRING_TYPENAME range_const_iterator<RangeT>::type> lit_input(as_literal(Input)); iterator_range<BOOST_STRING_TYPENAME range_const_iterator<RangeT>::type> lit_input(::boost::as_literal(Input));
return detail::find_format_all_copy_impl( return detail::find_format_all_copy_impl(
Output, Output,
lit_input, lit_input,
Finder, Finder,
Formatter, Formatter,
Finder(begin(lit_input), end(lit_input))); Finder(::boost::begin(lit_input), ::boost::end(lit_input)));
} }
//! Generic replace all algorithm //! Generic replace all algorithm
@@ -203,19 +216,22 @@ namespace boost {
FormatterT Formatter ) FormatterT Formatter )
{ {
// Concept check // Concept check
function_requires< BOOST_CONCEPT_ASSERT((
FinderConcept<FinderT, FinderConcept<
BOOST_STRING_TYPENAME range_const_iterator<SequenceT>::type> >(); FinderT,
function_requires< BOOST_STRING_TYPENAME range_const_iterator<SequenceT>::type>
));
BOOST_CONCEPT_ASSERT((
FormatterConcept< FormatterConcept<
FormatterT, FormatterT,
FinderT,BOOST_STRING_TYPENAME range_const_iterator<SequenceT>::type> >(); FinderT,BOOST_STRING_TYPENAME range_const_iterator<SequenceT>::type>
));
return detail::find_format_all_copy_impl( return detail::find_format_all_copy_impl(
Input, Input,
Finder, Finder,
Formatter, Formatter,
Finder( begin(Input), end(Input) ) ); Finder( ::boost::begin(Input), ::boost::end(Input) ) );
} }
//! Generic replace all algorithm //! Generic replace all algorithm
@@ -238,19 +254,22 @@ namespace boost {
FormatterT Formatter ) FormatterT Formatter )
{ {
// Concept check // Concept check
function_requires< BOOST_CONCEPT_ASSERT((
FinderConcept<FinderT, FinderConcept<
BOOST_STRING_TYPENAME range_const_iterator<SequenceT>::type> >(); FinderT,
function_requires< BOOST_STRING_TYPENAME range_const_iterator<SequenceT>::type>
));
BOOST_CONCEPT_ASSERT((
FormatterConcept< FormatterConcept<
FormatterT, FormatterT,
FinderT,BOOST_STRING_TYPENAME range_const_iterator<SequenceT>::type> >(); FinderT,BOOST_STRING_TYPENAME range_const_iterator<SequenceT>::type>
));
detail::find_format_all_impl( detail::find_format_all_impl(
Input, Input,
Finder, Finder,
Formatter, Formatter,
Finder(begin(Input), end(Input))); Finder(::boost::begin(Input), ::boost::end(Input)));
} }

View File

@@ -18,13 +18,13 @@
#include <boost/range/iterator_range.hpp> #include <boost/range/iterator_range.hpp>
#include <boost/range/begin.hpp> #include <boost/range/begin.hpp>
#include <boost/range/end.hpp> #include <boost/range/end.hpp>
#include <boost/range/result_iterator.hpp> #include <boost/range/iterator.hpp>
#include <boost/range/as_literal.hpp> #include <boost/range/as_literal.hpp>
#include <boost/algorithm/string/detail/find_iterator.hpp> #include <boost/algorithm/string/detail/find_iterator.hpp>
/*! \file /*! \file
Defines find iterator classes. Find iterator repeatly applies a Finder Defines find iterator classes. Find iterator repeatedly applies a Finder
to the specified input string to search for matches. Dereferencing to the specified input string to search for matches. Dereferencing
the iterator yields the current match or a range between the last and the current the iterator yields the current match or a range between the last and the current
match depending on the iterator used. match depending on the iterator used.
@@ -58,12 +58,6 @@ namespace boost {
// facade support // facade support
friend class ::boost::iterator_core_access; friend class ::boost::iterator_core_access;
// base type
typedef iterator_facade<
find_iterator<IteratorT>,
const iterator_range<IteratorT>,
forward_traversal_tag> facade_type;
private: private:
// typedefs // typedefs
@@ -119,9 +113,9 @@ namespace boost {
FinderT Finder ) : FinderT Finder ) :
detail::find_iterator_base<IteratorT>(Finder,0) detail::find_iterator_base<IteratorT>(Finder,0)
{ {
iterator_range<BOOST_STRING_TYPENAME range_iterator<RangeT>::type> lit_col(as_literal(Col)); iterator_range<BOOST_STRING_TYPENAME range_iterator<RangeT>::type> lit_col(::boost::as_literal(Col));
m_Match=make_iterator_range(begin(lit_col), begin(lit_col)); m_Match=::boost::make_iterator_range(::boost::begin(lit_col), ::boost::begin(lit_col));
m_End=end(lit_col); m_End=::boost::end(lit_col);
increment(); increment();
} }
@@ -185,12 +179,12 @@ namespace boost {
*/ */
template<typename RangeT, typename FinderT> template<typename RangeT, typename FinderT>
inline find_iterator< inline find_iterator<
BOOST_STRING_TYPENAME range_result_iterator<RangeT>::type> BOOST_STRING_TYPENAME range_iterator<RangeT>::type>
make_find_iterator( make_find_iterator(
RangeT& Collection, RangeT& Collection,
FinderT Finder) FinderT Finder)
{ {
return find_iterator<BOOST_STRING_TYPENAME range_result_iterator<RangeT>::type>( return find_iterator<BOOST_STRING_TYPENAME range_iterator<RangeT>::type>(
Collection, Finder); Collection, Finder);
} }
@@ -220,12 +214,6 @@ namespace boost {
// facade support // facade support
friend class ::boost::iterator_core_access; friend class ::boost::iterator_core_access;
// base type
typedef iterator_facade<
find_iterator<IteratorT>,
iterator_range<IteratorT>,
forward_traversal_tag> facade_type;
private: private:
// typedefs // typedefs
@@ -252,7 +240,7 @@ namespace boost {
m_Match(Other.m_Match), m_Match(Other.m_Match),
m_Next(Other.m_Next), m_Next(Other.m_Next),
m_End(Other.m_End), m_End(Other.m_End),
m_bEof(false) m_bEof(Other.m_bEof)
{} {}
//! Constructor //! Constructor
@@ -271,7 +259,11 @@ namespace boost {
m_End(End), m_End(End),
m_bEof(false) m_bEof(false)
{ {
increment(); // force the correct behavior for empty sequences and yield at least one token
if(Begin!=End)
{
increment();
}
} }
//! Constructor //! Constructor
/*! /*!
@@ -285,12 +277,16 @@ namespace boost {
detail::find_iterator_base<IteratorT>(Finder,0), detail::find_iterator_base<IteratorT>(Finder,0),
m_bEof(false) m_bEof(false)
{ {
iterator_range<BOOST_STRING_TYPENAME range_iterator<RangeT>::type> lit_col(as_literal(Col)); iterator_range<BOOST_STRING_TYPENAME range_iterator<RangeT>::type> lit_col(::boost::as_literal(Col));
m_Match=make_iterator_range(begin(lit_col), begin(lit_col)); m_Match=make_iterator_range(::boost::begin(lit_col), ::boost::begin(lit_col));
m_Next=begin(lit_col); m_Next=::boost::begin(lit_col);
m_End=end(lit_col); m_End=::boost::end(lit_col);
increment(); // force the correct behavior for empty sequences and yield at least one token
if(m_Next!=m_End)
{
increment();
}
} }
@@ -363,12 +359,12 @@ namespace boost {
*/ */
template<typename RangeT, typename FinderT> template<typename RangeT, typename FinderT>
inline split_iterator< inline split_iterator<
BOOST_STRING_TYPENAME range_result_iterator<RangeT>::type> BOOST_STRING_TYPENAME range_iterator<RangeT>::type>
make_split_iterator( make_split_iterator(
RangeT& Collection, RangeT& Collection,
FinderT Finder) FinderT Finder)
{ {
return split_iterator<BOOST_STRING_TYPENAME range_result_iterator<RangeT>::type>( return split_iterator<BOOST_STRING_TYPENAME range_iterator<RangeT>::type>(
Collection, Finder); Collection, Finder);
} }

View File

@@ -56,7 +56,7 @@ namespace boost {
detail::first_finderF< detail::first_finderF<
BOOST_STRING_TYPENAME BOOST_STRING_TYPENAME
range_const_iterator<RangeT>::type, range_const_iterator<RangeT>::type,
is_equal>( as_literal(Search), is_equal() ) ; is_equal>( ::boost::as_literal(Search), is_equal() ) ;
} }
//! "First" finder //! "First" finder
@@ -74,7 +74,7 @@ namespace boost {
detail::first_finderF< detail::first_finderF<
BOOST_STRING_TYPENAME BOOST_STRING_TYPENAME
range_const_iterator<RangeT>::type, range_const_iterator<RangeT>::type,
PredicateT>( as_literal(Search), Comp ); PredicateT>( ::boost::as_literal(Search), Comp );
} }
//! "Last" finder //! "Last" finder
@@ -97,7 +97,7 @@ namespace boost {
detail::last_finderF< detail::last_finderF<
BOOST_STRING_TYPENAME BOOST_STRING_TYPENAME
range_const_iterator<RangeT>::type, range_const_iterator<RangeT>::type,
is_equal>( as_literal(Search), is_equal() ); is_equal>( ::boost::as_literal(Search), is_equal() );
} }
//! "Last" finder //! "Last" finder
/*! /*!
@@ -113,7 +113,7 @@ namespace boost {
detail::last_finderF< detail::last_finderF<
BOOST_STRING_TYPENAME BOOST_STRING_TYPENAME
range_const_iterator<RangeT>::type, range_const_iterator<RangeT>::type,
PredicateT>( as_literal(Search), Comp ) ; PredicateT>( ::boost::as_literal(Search), Comp ) ;
} }
//! "Nth" finder //! "Nth" finder
@@ -139,7 +139,7 @@ namespace boost {
detail::nth_finderF< detail::nth_finderF<
BOOST_STRING_TYPENAME BOOST_STRING_TYPENAME
range_const_iterator<RangeT>::type, range_const_iterator<RangeT>::type,
is_equal>( as_literal(Search), Nth, is_equal() ) ; is_equal>( ::boost::as_literal(Search), Nth, is_equal() ) ;
} }
//! "Nth" finder //! "Nth" finder
/*! /*!
@@ -158,7 +158,7 @@ namespace boost {
detail::nth_finderF< detail::nth_finderF<
BOOST_STRING_TYPENAME BOOST_STRING_TYPENAME
range_const_iterator<RangeT>::type, range_const_iterator<RangeT>::type,
PredicateT>( as_literal(Search), Nth, Comp ); PredicateT>( ::boost::as_literal(Search), Nth, Comp );
} }
//! "Head" finder //! "Head" finder

View File

@@ -36,7 +36,7 @@ namespace boost {
//! Constant formatter //! Constant formatter
/*! /*!
Construct the \c const_formatter. Const formatter always returns Constructs a \c const_formatter. Const formatter always returns
the same value, regardless of the parameter. the same value, regardless of the parameter.
\param Format A predefined value used as a result for formating \param Format A predefined value used as a result for formating
@@ -50,12 +50,12 @@ namespace boost {
{ {
return detail::const_formatF< return detail::const_formatF<
iterator_range< iterator_range<
BOOST_STRING_TYPENAME range_const_iterator<RangeT>::type> >(as_literal(Format)); BOOST_STRING_TYPENAME range_const_iterator<RangeT>::type> >(::boost::as_literal(Format));
} }
//! Identity formatter //! Identity formatter
/*! /*!
Construct the \c identity_formatter. Identity formatter always returns Constructs an \c identity_formatter. Identity formatter always returns
the parameter. the parameter.
\return An instance of the \c identity_formatter object. \return An instance of the \c identity_formatter object.
@@ -73,7 +73,7 @@ namespace boost {
//! Empty formatter //! Empty formatter
/*! /*!
Construct the \c empty_formatter. Empty formatter always returns an empty Constructs an \c empty_formatter. Empty formatter always returns an empty
sequence. sequence.
\param Input container used to select a correct value_type for the \param Input container used to select a correct value_type for the
@@ -89,6 +89,22 @@ namespace boost {
BOOST_STRING_TYPENAME range_value<RangeT>::type>(); BOOST_STRING_TYPENAME range_value<RangeT>::type>();
} }
//! Empty formatter
/*!
Constructs a \c dissect_formatter. Dissect formatter uses a specified finder
to extract a portion of the formatted sequence. The first finder's match is returned
as a result
\param Finder a finder used to select a portion of the formated sequence
\return An instance of the \c dissect_formatter object.
*/
template<typename FinderT>
inline detail::dissect_formatF< FinderT >
dissect_formatter(const FinderT& Finder)
{
return detail::dissect_formatF<FinderT>(Finder);
}
} // namespace algorithm } // namespace algorithm
@@ -96,6 +112,7 @@ namespace boost {
using algorithm::const_formatter; using algorithm::const_formatter;
using algorithm::identity_formatter; using algorithm::identity_formatter;
using algorithm::empty_formatter; using algorithm::empty_formatter;
using algorithm::dissect_formatter;
} // namespace boost } // namespace boost

View File

@@ -19,7 +19,7 @@
#include <boost/range/iterator_range.hpp> #include <boost/range/iterator_range.hpp>
#include <boost/range/begin.hpp> #include <boost/range/begin.hpp>
#include <boost/range/end.hpp> #include <boost/range/end.hpp>
#include <boost/range/result_iterator.hpp> #include <boost/range/iterator.hpp>
#include <boost/range/value_type.hpp> #include <boost/range/value_type.hpp>
#include <boost/range/as_literal.hpp> #include <boost/range/as_literal.hpp>
@@ -74,32 +74,34 @@ namespace boost {
RangeT& Input, RangeT& Input,
FinderT Finder ) FinderT Finder )
{ {
function_requires< BOOST_CONCEPT_ASSERT((
FinderConcept<FinderT, FinderConcept<
BOOST_STRING_TYPENAME range_result_iterator<RangeT>::type> >(); FinderT,
BOOST_STRING_TYPENAME range_iterator<RangeT>::type>
));
iterator_range<BOOST_STRING_TYPENAME range_iterator<RangeT>::type> lit_input(as_literal(Input)); iterator_range<BOOST_STRING_TYPENAME range_iterator<RangeT>::type> lit_input(::boost::as_literal(Input));
typedef BOOST_STRING_TYPENAME typedef BOOST_STRING_TYPENAME
range_result_iterator<RangeT>::type input_iterator_type; range_iterator<RangeT>::type input_iterator_type;
typedef find_iterator<input_iterator_type> find_iterator_type; typedef find_iterator<input_iterator_type> find_iterator_type;
typedef detail::copy_iterator_rangeF< typedef detail::copy_iterator_rangeF<
BOOST_STRING_TYPENAME BOOST_STRING_TYPENAME
range_value<SequenceSequenceT>::type, range_value<SequenceSequenceT>::type,
input_iterator_type> copy_range_type; input_iterator_type> copy_range_type;
input_iterator_type InputEnd=end(lit_input); input_iterator_type InputEnd=::boost::end(lit_input);
typedef transform_iterator<copy_range_type, find_iterator_type> typedef transform_iterator<copy_range_type, find_iterator_type>
transform_iter_type; transform_iter_type;
transform_iter_type itBegin= transform_iter_type itBegin=
make_transform_iterator( ::boost::make_transform_iterator(
find_iterator_type( begin(lit_input), InputEnd, Finder ), find_iterator_type( ::boost::begin(lit_input), InputEnd, Finder ),
copy_range_type()); copy_range_type());
transform_iter_type itEnd= transform_iter_type itEnd=
make_transform_iterator( ::boost::make_transform_iterator(
find_iterator_type(), find_iterator_type(),
copy_range_type()); copy_range_type());
@@ -143,32 +145,33 @@ namespace boost {
RangeT& Input, RangeT& Input,
FinderT Finder ) FinderT Finder )
{ {
function_requires< BOOST_CONCEPT_ASSERT((
FinderConcept<FinderT, FinderConcept<FinderT,
BOOST_STRING_TYPENAME range_result_iterator<RangeT>::type> >(); BOOST_STRING_TYPENAME range_iterator<RangeT>::type>
));
iterator_range<BOOST_STRING_TYPENAME range_iterator<RangeT>::type> lit_input(as_literal(Input)); iterator_range<BOOST_STRING_TYPENAME range_iterator<RangeT>::type> lit_input(::boost::as_literal(Input));
typedef BOOST_STRING_TYPENAME typedef BOOST_STRING_TYPENAME
range_result_iterator<RangeT>::type input_iterator_type; range_iterator<RangeT>::type input_iterator_type;
typedef split_iterator<input_iterator_type> find_iterator_type; typedef split_iterator<input_iterator_type> find_iterator_type;
typedef detail::copy_iterator_rangeF< typedef detail::copy_iterator_rangeF<
BOOST_STRING_TYPENAME BOOST_STRING_TYPENAME
range_value<SequenceSequenceT>::type, range_value<SequenceSequenceT>::type,
input_iterator_type> copy_range_type; input_iterator_type> copy_range_type;
input_iterator_type InputEnd=end(lit_input); input_iterator_type InputEnd=::boost::end(lit_input);
typedef transform_iterator<copy_range_type, find_iterator_type> typedef transform_iterator<copy_range_type, find_iterator_type>
transform_iter_type; transform_iter_type;
transform_iter_type itBegin= transform_iter_type itBegin=
make_transform_iterator( ::boost::make_transform_iterator(
find_iterator_type( begin(lit_input), InputEnd, Finder ), find_iterator_type( ::boost::begin(lit_input), InputEnd, Finder ),
copy_range_type() ); copy_range_type() );
transform_iter_type itEnd= transform_iter_type itEnd=
make_transform_iterator( ::boost::make_transform_iterator(
find_iterator_type(), find_iterator_type(),
copy_range_type() ); copy_range_type() );

View File

@@ -14,7 +14,7 @@
#include <boost/algorithm/string/config.hpp> #include <boost/algorithm/string/config.hpp>
#include <boost/algorithm/string/detail/sequence.hpp> #include <boost/algorithm/string/detail/sequence.hpp>
#include <boost/range/value_type.hpp> #include <boost/range/value_type.hpp>
#include <boost/range/as_literal.hpp>
/*! \file /*! \file
Defines join algorithm. Defines join algorithm.
@@ -52,8 +52,8 @@ namespace boost {
typedef typename range_const_iterator<SequenceSequenceT>::type InputIteratorT; typedef typename range_const_iterator<SequenceSequenceT>::type InputIteratorT;
// Parse input // Parse input
InputIteratorT itBegin=begin(Input); InputIteratorT itBegin=::boost::begin(Input);
InputIteratorT itEnd=end(Input); InputIteratorT itEnd=::boost::end(Input);
// Construct container to hold the result // Construct container to hold the result
ResultT Result; ResultT Result;
@@ -61,16 +61,16 @@ namespace boost {
// Append first element // Append first element
if(itBegin!=itEnd) if(itBegin!=itEnd)
{ {
detail::insert(Result, end(Result), *itBegin); detail::insert(Result, ::boost::end(Result), *itBegin);
++itBegin; ++itBegin;
} }
for(;itBegin!=itEnd; ++itBegin) for(;itBegin!=itEnd; ++itBegin)
{ {
// Add separator // Add separator
detail::insert(Result, end(Result), as_literal(Separator)); detail::insert(Result, ::boost::end(Result), ::boost::as_literal(Separator));
// Add element // Add element
detail::insert(Result, end(Result), *itBegin); detail::insert(Result, ::boost::end(Result), *itBegin);
} }
return Result; return Result;
@@ -103,8 +103,8 @@ namespace boost {
typedef typename range_const_iterator<SequenceSequenceT>::type InputIteratorT; typedef typename range_const_iterator<SequenceSequenceT>::type InputIteratorT;
// Parse input // Parse input
InputIteratorT itBegin=begin(Input); InputIteratorT itBegin=::boost::begin(Input);
InputIteratorT itEnd=end(Input); InputIteratorT itEnd=::boost::end(Input);
// Construct container to hold the result // Construct container to hold the result
ResultT Result; ResultT Result;
@@ -114,7 +114,7 @@ namespace boost {
// Add this element // Add this element
if(itBegin!=itEnd) if(itBegin!=itEnd)
{ {
detail::insert(Result, end(Result), *itBegin); detail::insert(Result, ::boost::end(Result), *itBegin);
++itBegin; ++itBegin;
} }
@@ -123,9 +123,9 @@ namespace boost {
if(Pred(*itBegin)) if(Pred(*itBegin))
{ {
// Add separator // Add separator
detail::insert(Result, end(Result), as_literal(Separator)); detail::insert(Result, ::boost::end(Result), ::boost::as_literal(Separator));
// Add element // Add element
detail::insert(Result, end(Result), *itBegin); detail::insert(Result, ::boost::end(Result), *itBegin);
} }
} }

View File

@@ -59,19 +59,19 @@ namespace boost {
const Range2T& Test, const Range2T& Test,
PredicateT Comp) PredicateT Comp)
{ {
iterator_range<BOOST_STRING_TYPENAME range_const_iterator<Range1T>::type> lit_input(as_literal(Input)); iterator_range<BOOST_STRING_TYPENAME range_const_iterator<Range1T>::type> lit_input(::boost::as_literal(Input));
iterator_range<BOOST_STRING_TYPENAME range_const_iterator<Range2T>::type> lit_test(as_literal(Test)); iterator_range<BOOST_STRING_TYPENAME range_const_iterator<Range2T>::type> lit_test(::boost::as_literal(Test));
typedef BOOST_STRING_TYPENAME typedef BOOST_STRING_TYPENAME
range_const_iterator<Range1T>::type Iterator1T; range_const_iterator<Range1T>::type Iterator1T;
typedef BOOST_STRING_TYPENAME typedef BOOST_STRING_TYPENAME
range_const_iterator<Range2T>::type Iterator2T; range_const_iterator<Range2T>::type Iterator2T;
Iterator1T InputEnd=end(lit_input); Iterator1T InputEnd=::boost::end(lit_input);
Iterator2T TestEnd=end(lit_test); Iterator2T TestEnd=::boost::end(lit_test);
Iterator1T it=begin(lit_input); Iterator1T it=::boost::begin(lit_input);
Iterator2T pit=begin(lit_test); Iterator2T pit=::boost::begin(lit_test);
for(; for(;
it!=InputEnd && pit!=TestEnd; it!=InputEnd && pit!=TestEnd;
++it,++pit) ++it,++pit)
@@ -92,7 +92,7 @@ namespace boost {
const Range1T& Input, const Range1T& Input,
const Range2T& Test) const Range2T& Test)
{ {
return starts_with(Input, Test, is_equal()); return ::boost::algorithm::starts_with(Input, Test, is_equal());
} }
//! 'Starts with' predicate ( case insensitive ) //! 'Starts with' predicate ( case insensitive )
@@ -114,7 +114,7 @@ namespace boost {
const Range2T& Test, const Range2T& Test,
const std::locale& Loc=std::locale()) const std::locale& Loc=std::locale())
{ {
return starts_with(Input, Test, is_iequal(Loc)); return ::boost::algorithm::starts_with(Input, Test, is_iequal(Loc));
} }
@@ -141,8 +141,8 @@ namespace boost {
const Range2T& Test, const Range2T& Test,
PredicateT Comp) PredicateT Comp)
{ {
iterator_range<BOOST_STRING_TYPENAME range_const_iterator<Range1T>::type> lit_input(as_literal(Input)); iterator_range<BOOST_STRING_TYPENAME range_const_iterator<Range1T>::type> lit_input(::boost::as_literal(Input));
iterator_range<BOOST_STRING_TYPENAME range_const_iterator<Range2T>::type> lit_test(as_literal(Test)); iterator_range<BOOST_STRING_TYPENAME range_const_iterator<Range2T>::type> lit_test(::boost::as_literal(Test));
typedef BOOST_STRING_TYPENAME typedef BOOST_STRING_TYPENAME
range_const_iterator<Range1T>::type Iterator1T; range_const_iterator<Range1T>::type Iterator1T;
@@ -151,10 +151,10 @@ namespace boost {
return detail:: return detail::
ends_with_iter_select( ends_with_iter_select(
begin(lit_input), ::boost::begin(lit_input),
end(lit_input), ::boost::end(lit_input),
begin(lit_test), ::boost::begin(lit_test),
end(lit_test), ::boost::end(lit_test),
Comp, Comp,
category()); category());
} }
@@ -169,7 +169,7 @@ namespace boost {
const Range1T& Input, const Range1T& Input,
const Range2T& Test) const Range2T& Test)
{ {
return ends_with(Input, Test, is_equal()); return ::boost::algorithm::ends_with(Input, Test, is_equal());
} }
//! 'Ends with' predicate ( case insensitive ) //! 'Ends with' predicate ( case insensitive )
@@ -191,7 +191,7 @@ namespace boost {
const Range2T& Test, const Range2T& Test,
const std::locale& Loc=std::locale()) const std::locale& Loc=std::locale())
{ {
return ends_with(Input, Test, is_iequal(Loc)); return ::boost::algorithm::ends_with(Input, Test, is_iequal(Loc));
} }
// contains predicate -----------------------------------------------// // contains predicate -----------------------------------------------//
@@ -215,17 +215,17 @@ namespace boost {
const Range2T& Test, const Range2T& Test,
PredicateT Comp) PredicateT Comp)
{ {
iterator_range<BOOST_STRING_TYPENAME range_const_iterator<Range1T>::type> lit_input(as_literal(Input)); iterator_range<BOOST_STRING_TYPENAME range_const_iterator<Range1T>::type> lit_input(::boost::as_literal(Input));
iterator_range<BOOST_STRING_TYPENAME range_const_iterator<Range2T>::type> lit_test(as_literal(Test)); iterator_range<BOOST_STRING_TYPENAME range_const_iterator<Range2T>::type> lit_test(::boost::as_literal(Test));
if (empty(lit_test)) if (::boost::empty(lit_test))
{ {
// Empty range is contained always // Empty range is contained always
return true; return true;
} }
// Use the temporary variable to make VACPP happy // Use the temporary variable to make VACPP happy
bool bResult=(first_finder(lit_test,Comp)(begin(lit_input), end(lit_input))); bool bResult=(::boost::algorithm::first_finder(lit_test,Comp)(::boost::begin(lit_input), ::boost::end(lit_input)));
return bResult; return bResult;
} }
@@ -238,7 +238,7 @@ namespace boost {
const Range1T& Input, const Range1T& Input,
const Range2T& Test) const Range2T& Test)
{ {
return contains(Input, Test, is_equal()); return ::boost::algorithm::contains(Input, Test, is_equal());
} }
//! 'Contains' predicate ( case insensitive ) //! 'Contains' predicate ( case insensitive )
@@ -259,7 +259,7 @@ namespace boost {
const Range2T& Test, const Range2T& Test,
const std::locale& Loc=std::locale()) const std::locale& Loc=std::locale())
{ {
return contains(Input, Test, is_iequal(Loc)); return ::boost::algorithm::contains(Input, Test, is_iequal(Loc));
} }
// equals predicate -----------------------------------------------// // equals predicate -----------------------------------------------//
@@ -286,19 +286,19 @@ namespace boost {
const Range2T& Test, const Range2T& Test,
PredicateT Comp) PredicateT Comp)
{ {
iterator_range<BOOST_STRING_TYPENAME range_const_iterator<Range1T>::type> lit_input(as_literal(Input)); iterator_range<BOOST_STRING_TYPENAME range_const_iterator<Range1T>::type> lit_input(::boost::as_literal(Input));
iterator_range<BOOST_STRING_TYPENAME range_const_iterator<Range2T>::type> lit_test(as_literal(Test)); iterator_range<BOOST_STRING_TYPENAME range_const_iterator<Range2T>::type> lit_test(::boost::as_literal(Test));
typedef BOOST_STRING_TYPENAME typedef BOOST_STRING_TYPENAME
range_const_iterator<Range1T>::type Iterator1T; range_const_iterator<Range1T>::type Iterator1T;
typedef BOOST_STRING_TYPENAME typedef BOOST_STRING_TYPENAME
range_const_iterator<Range2T>::type Iterator2T; range_const_iterator<Range2T>::type Iterator2T;
Iterator1T InputEnd=end(lit_input); Iterator1T InputEnd=::boost::end(lit_input);
Iterator2T TestEnd=end(lit_test); Iterator2T TestEnd=::boost::end(lit_test);
Iterator1T it=begin(lit_input); Iterator1T it=::boost::begin(lit_input);
Iterator2T pit=begin(lit_test); Iterator2T pit=::boost::begin(lit_test);
for(; for(;
it!=InputEnd && pit!=TestEnd; it!=InputEnd && pit!=TestEnd;
++it,++pit) ++it,++pit)
@@ -319,7 +319,7 @@ namespace boost {
const Range1T& Input, const Range1T& Input,
const Range2T& Test) const Range2T& Test)
{ {
return equals(Input, Test, is_equal()); return ::boost::algorithm::equals(Input, Test, is_equal());
} }
//! 'Equals' predicate ( case insensitive ) //! 'Equals' predicate ( case insensitive )
@@ -343,7 +343,7 @@ namespace boost {
const Range2T& Test, const Range2T& Test,
const std::locale& Loc=std::locale()) const std::locale& Loc=std::locale())
{ {
return equals(Input, Test, is_iequal(Loc)); return ::boost::algorithm::equals(Input, Test, is_iequal(Loc));
} }
// lexicographical_compare predicate -----------------------------// // lexicographical_compare predicate -----------------------------//
@@ -372,14 +372,14 @@ namespace boost {
const Range2T& Arg2, const Range2T& Arg2,
PredicateT Pred) PredicateT Pred)
{ {
iterator_range<BOOST_STRING_TYPENAME range_const_iterator<Range1T>::type> lit_arg1(as_literal(Arg1)); iterator_range<BOOST_STRING_TYPENAME range_const_iterator<Range1T>::type> lit_arg1(::boost::as_literal(Arg1));
iterator_range<BOOST_STRING_TYPENAME range_const_iterator<Range2T>::type> lit_arg2(as_literal(Arg2)); iterator_range<BOOST_STRING_TYPENAME range_const_iterator<Range2T>::type> lit_arg2(::boost::as_literal(Arg2));
return std::lexicographical_compare( return std::lexicographical_compare(
begin(lit_arg1), ::boost::begin(lit_arg1),
end(lit_arg1), ::boost::end(lit_arg1),
begin(lit_arg2), ::boost::begin(lit_arg2),
end(lit_arg2), ::boost::end(lit_arg2),
Pred); Pred);
} }
@@ -392,7 +392,7 @@ namespace boost {
const Range1T& Arg1, const Range1T& Arg1,
const Range2T& Arg2) const Range2T& Arg2)
{ {
return lexicographical_compare(Arg1, Arg2, is_less()); return ::boost::algorithm::lexicographical_compare(Arg1, Arg2, is_less());
} }
//! Lexicographical compare predicate (case-insensitive) //! Lexicographical compare predicate (case-insensitive)
@@ -417,7 +417,7 @@ namespace boost {
const Range2T& Arg2, const Range2T& Arg2,
const std::locale& Loc=std::locale()) const std::locale& Loc=std::locale())
{ {
return lexicographical_compare(Arg1, Arg2, is_iless(Loc)); return ::boost::algorithm::lexicographical_compare(Arg1, Arg2, is_iless(Loc));
} }
@@ -439,13 +439,13 @@ namespace boost {
const RangeT& Input, const RangeT& Input,
PredicateT Pred) PredicateT Pred)
{ {
iterator_range<BOOST_STRING_TYPENAME range_const_iterator<RangeT>::type> lit_input(as_literal(Input)); iterator_range<BOOST_STRING_TYPENAME range_const_iterator<RangeT>::type> lit_input(::boost::as_literal(Input));
typedef BOOST_STRING_TYPENAME typedef BOOST_STRING_TYPENAME
range_const_iterator<RangeT>::type Iterator1T; range_const_iterator<RangeT>::type Iterator1T;
Iterator1T InputEnd=end(lit_input); Iterator1T InputEnd=::boost::end(lit_input);
for( Iterator1T It=begin(lit_input); It!=InputEnd; ++It) for( Iterator1T It=::boost::begin(lit_input); It!=InputEnd; ++It)
{ {
if (!Pred(*It)) if (!Pred(*It))
return false; return false;

View File

@@ -17,7 +17,7 @@
#include <boost/range/iterator_range.hpp> #include <boost/range/iterator_range.hpp>
#include <boost/range/begin.hpp> #include <boost/range/begin.hpp>
#include <boost/range/end.hpp> #include <boost/range/end.hpp>
#include <boost/range/result_iterator.hpp> #include <boost/range/iterator.hpp>
#include <boost/range/as_literal.hpp> #include <boost/range/as_literal.hpp>
#include <boost/algorithm/string/find_format.hpp> #include <boost/algorithm/string/find_format.hpp>
@@ -54,16 +54,16 @@ namespace boost {
typename CharT, typename CharT,
typename RegexTraitsT> typename RegexTraitsT>
inline iterator_range< inline iterator_range<
BOOST_STRING_TYPENAME range_result_iterator<RangeT>::type > BOOST_STRING_TYPENAME range_iterator<RangeT>::type >
find_regex( find_regex(
RangeT& Input, RangeT& Input,
const basic_regex<CharT, RegexTraitsT>& Rx, const basic_regex<CharT, RegexTraitsT>& Rx,
match_flag_type Flags=match_default ) match_flag_type Flags=match_default )
{ {
iterator_range<BOOST_STRING_TYPENAME range_iterator<RangeT>::type> lit_input(as_literal(Input)); iterator_range<BOOST_STRING_TYPENAME range_iterator<RangeT>::type> lit_input(::boost::as_literal(Input));
return regex_finder(Rx,Flags)( return ::boost::algorithm::regex_finder(Rx,Flags)(
begin(lit_input), end(lit_input) ); ::boost::begin(lit_input), ::boost::end(lit_input) );
} }
// replace_regex --------------------------------------------------------------------// // replace_regex --------------------------------------------------------------------//
@@ -98,11 +98,11 @@ namespace boost {
const std::basic_string<CharT, FormatStringTraitsT, FormatStringAllocatorT>& Format, const std::basic_string<CharT, FormatStringTraitsT, FormatStringAllocatorT>& Format,
match_flag_type Flags=match_default | format_default ) match_flag_type Flags=match_default | format_default )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Output, Output,
Input, Input,
regex_finder( Rx, Flags ), ::boost::algorithm::regex_finder( Rx, Flags ),
regex_formatter( Format, Flags ) ); ::boost::algorithm::regex_formatter( Format, Flags ) );
} }
//! Replace regex algorithm //! Replace regex algorithm
@@ -120,10 +120,10 @@ namespace boost {
const std::basic_string<CharT, FormatStringTraitsT, FormatStringAllocatorT>& Format, const std::basic_string<CharT, FormatStringTraitsT, FormatStringAllocatorT>& Format,
match_flag_type Flags=match_default | format_default ) match_flag_type Flags=match_default | format_default )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Input, Input,
regex_finder( Rx, Flags ), ::boost::algorithm::regex_finder( Rx, Flags ),
regex_formatter( Format, Flags ) ); ::boost::algorithm::regex_formatter( Format, Flags ) );
} }
//! Replace regex algorithm //! Replace regex algorithm
@@ -147,10 +147,10 @@ namespace boost {
const std::basic_string<CharT, FormatStringTraitsT, FormatStringAllocatorT>& Format, const std::basic_string<CharT, FormatStringTraitsT, FormatStringAllocatorT>& Format,
match_flag_type Flags=match_default | format_default ) match_flag_type Flags=match_default | format_default )
{ {
find_format( ::boost::algorithm::find_format(
Input, Input,
regex_finder( Rx, Flags ), ::boost::algorithm::regex_finder( Rx, Flags ),
regex_formatter( Format, Flags ) ); ::boost::algorithm::regex_formatter( Format, Flags ) );
} }
// replace_all_regex --------------------------------------------------------------------// // replace_all_regex --------------------------------------------------------------------//
@@ -184,11 +184,11 @@ namespace boost {
const std::basic_string<CharT, FormatStringTraitsT, FormatStringAllocatorT>& Format, const std::basic_string<CharT, FormatStringTraitsT, FormatStringAllocatorT>& Format,
match_flag_type Flags=match_default | format_default ) match_flag_type Flags=match_default | format_default )
{ {
return find_format_all_copy( return ::boost::algorithm::find_format_all_copy(
Output, Output,
Input, Input,
regex_finder( Rx, Flags ), ::boost::algorithm::regex_finder( Rx, Flags ),
regex_formatter( Format, Flags ) ); ::boost::algorithm::regex_formatter( Format, Flags ) );
} }
//! Replace all regex algorithm //! Replace all regex algorithm
@@ -206,10 +206,10 @@ namespace boost {
const std::basic_string<CharT, FormatStringTraitsT, FormatStringAllocatorT>& Format, const std::basic_string<CharT, FormatStringTraitsT, FormatStringAllocatorT>& Format,
match_flag_type Flags=match_default | format_default ) match_flag_type Flags=match_default | format_default )
{ {
return find_format_all_copy( return ::boost::algorithm::find_format_all_copy(
Input, Input,
regex_finder( Rx, Flags ), ::boost::algorithm::regex_finder( Rx, Flags ),
regex_formatter( Format, Flags ) ); ::boost::algorithm::regex_formatter( Format, Flags ) );
} }
//! Replace all regex algorithm //! Replace all regex algorithm
@@ -233,10 +233,10 @@ namespace boost {
const std::basic_string<CharT, FormatStringTraitsT, FormatStringAllocatorT>& Format, const std::basic_string<CharT, FormatStringTraitsT, FormatStringAllocatorT>& Format,
match_flag_type Flags=match_default | format_default ) match_flag_type Flags=match_default | format_default )
{ {
find_format_all( ::boost::algorithm::find_format_all(
Input, Input,
regex_finder( Rx, Flags ), ::boost::algorithm::regex_finder( Rx, Flags ),
regex_formatter( Format, Flags ) ); ::boost::algorithm::regex_formatter( Format, Flags ) );
} }
// erase_regex --------------------------------------------------------------------// // erase_regex --------------------------------------------------------------------//
@@ -267,11 +267,11 @@ namespace boost {
const basic_regex<CharT, RegexTraitsT>& Rx, const basic_regex<CharT, RegexTraitsT>& Rx,
match_flag_type Flags=match_default ) match_flag_type Flags=match_default )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Output, Output,
Input, Input,
regex_finder( Rx, Flags ), ::boost::algorithm::regex_finder( Rx, Flags ),
empty_formatter( Input ) ); ::boost::algorithm::empty_formatter( Input ) );
} }
//! Erase regex algorithm //! Erase regex algorithm
@@ -287,10 +287,10 @@ namespace boost {
const basic_regex<CharT, RegexTraitsT>& Rx, const basic_regex<CharT, RegexTraitsT>& Rx,
match_flag_type Flags=match_default ) match_flag_type Flags=match_default )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Input, Input,
regex_finder( Rx, Flags ), ::boost::algorithm::regex_finder( Rx, Flags ),
empty_formatter( Input ) ); ::boost::algorithm::empty_formatter( Input ) );
} }
//! Erase regex algorithm //! Erase regex algorithm
@@ -311,10 +311,10 @@ namespace boost {
const basic_regex<CharT, RegexTraitsT>& Rx, const basic_regex<CharT, RegexTraitsT>& Rx,
match_flag_type Flags=match_default ) match_flag_type Flags=match_default )
{ {
find_format( ::boost::algorithm::find_format(
Input, Input,
regex_finder( Rx, Flags ), ::boost::algorithm::regex_finder( Rx, Flags ),
empty_formatter( Input ) ); ::boost::algorithm::empty_formatter( Input ) );
} }
// erase_all_regex --------------------------------------------------------------------// // erase_all_regex --------------------------------------------------------------------//
@@ -346,11 +346,11 @@ namespace boost {
const basic_regex<CharT, RegexTraitsT>& Rx, const basic_regex<CharT, RegexTraitsT>& Rx,
match_flag_type Flags=match_default ) match_flag_type Flags=match_default )
{ {
return find_format_all_copy( return ::boost::algorithm::find_format_all_copy(
Output, Output,
Input, Input,
regex_finder( Rx, Flags ), ::boost::algorithm::regex_finder( Rx, Flags ),
empty_formatter( Input ) ); ::boost::algorithm::empty_formatter( Input ) );
} }
//! Erase all regex algorithm //! Erase all regex algorithm
@@ -366,10 +366,10 @@ namespace boost {
const basic_regex<CharT, RegexTraitsT>& Rx, const basic_regex<CharT, RegexTraitsT>& Rx,
match_flag_type Flags=match_default ) match_flag_type Flags=match_default )
{ {
return find_format_all_copy( return ::boost::algorithm::find_format_all_copy(
Input, Input,
regex_finder( Rx, Flags ), ::boost::algorithm::regex_finder( Rx, Flags ),
empty_formatter( Input ) ); ::boost::algorithm::empty_formatter( Input ) );
} }
//! Erase all regex algorithm //! Erase all regex algorithm
@@ -390,10 +390,10 @@ namespace boost {
const basic_regex<CharT, RegexTraitsT>& Rx, const basic_regex<CharT, RegexTraitsT>& Rx,
match_flag_type Flags=match_default ) match_flag_type Flags=match_default )
{ {
find_format_all( ::boost::algorithm::find_format_all(
Input, Input,
regex_finder( Rx, Flags ), ::boost::algorithm::regex_finder( Rx, Flags ),
empty_formatter( Input ) ); ::boost::algorithm::empty_formatter( Input ) );
} }
// find_all_regex ------------------------------------------------------------------// // find_all_regex ------------------------------------------------------------------//
@@ -431,10 +431,10 @@ namespace boost {
const basic_regex<CharT, RegexTraitsT>& Rx, const basic_regex<CharT, RegexTraitsT>& Rx,
match_flag_type Flags=match_default ) match_flag_type Flags=match_default )
{ {
return iter_find( return ::boost::algorithm::iter_find(
Result, Result,
Input, Input,
regex_finder(Rx,Flags) ); ::boost::algorithm::regex_finder(Rx,Flags) );
} }
// split_regex ------------------------------------------------------------------// // split_regex ------------------------------------------------------------------//
@@ -472,10 +472,10 @@ namespace boost {
const basic_regex<CharT, RegexTraitsT>& Rx, const basic_regex<CharT, RegexTraitsT>& Rx,
match_flag_type Flags=match_default ) match_flag_type Flags=match_default )
{ {
return iter_split( return ::boost::algorithm::iter_split(
Result, Result,
Input, Input,
regex_finder(Rx,Flags) ); ::boost::algorithm::regex_finder(Rx,Flags) );
} }
// join_if ------------------------------------------------------------------// // join_if ------------------------------------------------------------------//
@@ -515,8 +515,8 @@ namespace boost {
typedef typename range_const_iterator<SequenceSequenceT>::type InputIteratorT; typedef typename range_const_iterator<SequenceSequenceT>::type InputIteratorT;
// Parse input // Parse input
InputIteratorT itBegin=begin(Input); InputIteratorT itBegin=::boost::begin(Input);
InputIteratorT itEnd=end(Input); InputIteratorT itEnd=::boost::end(Input);
// Construct container to hold the result // Construct container to hold the result
ResultT Result; ResultT Result;
@@ -525,23 +525,23 @@ namespace boost {
// Roll to the first element that will be added // Roll to the first element that will be added
while( while(
itBegin!=itEnd && itBegin!=itEnd &&
!regex_match(begin(*itBegin), end(*itBegin), Rx, Flags)) ++itBegin; !::boost::regex_match(::boost::begin(*itBegin), ::boost::end(*itBegin), Rx, Flags)) ++itBegin;
// Add this element // Add this element
if(itBegin!=itEnd) if(itBegin!=itEnd)
{ {
detail::insert(Result, end(Result), *itBegin); detail::insert(Result, ::boost::end(Result), *itBegin);
++itBegin; ++itBegin;
} }
for(;itBegin!=itEnd; ++itBegin) for(;itBegin!=itEnd; ++itBegin)
{ {
if(regex_match(begin(*itBegin), end(*itBegin), Rx, Flags)) if(::boost::regex_match(::boost::begin(*itBegin), ::boost::end(*itBegin), Rx, Flags))
{ {
// Add separator // Add separator
detail::insert(Result, end(Result), as_literal(Separator)); detail::insert(Result, ::boost::end(Result), ::boost::as_literal(Separator));
// Add element // Add element
detail::insert(Result, end(Result), *itBegin); detail::insert(Result, ::boost::end(Result), *itBegin);
} }
} }
@@ -583,8 +583,8 @@ namespace boost {
typedef typename range_const_iterator<SequenceSequenceT>::type InputIteratorT; typedef typename range_const_iterator<SequenceSequenceT>::type InputIteratorT;
// Parse input // Parse input
InputIteratorT itBegin=begin(Input); InputIteratorT itBegin=::boost::begin(Input);
InputIteratorT itEnd=end(Input); InputIteratorT itEnd=::boost::end(Input);
// Construct container to hold the result // Construct container to hold the result
ResultT Result; ResultT Result;
@@ -593,23 +593,23 @@ namespace boost {
// Roll to the first element that will be added // Roll to the first element that will be added
while( while(
itBegin!=itEnd && itBegin!=itEnd &&
!regex_match(begin(*itBegin), end(*itBegin), Rx, Flags)) ++itBegin; !::boost::regex_match(::boost::begin(*itBegin), ::boost::end(*itBegin), Rx, Flags)) ++itBegin;
// Add this element // Add this element
if(itBegin!=itEnd) if(itBegin!=itEnd)
{ {
detail::insert(Result, end(Result), *itBegin); detail::insert(Result, ::boost::end(Result), *itBegin);
++itBegin; ++itBegin;
} }
for(;itBegin!=itEnd; ++itBegin) for(;itBegin!=itEnd; ++itBegin)
{ {
if(regex_match(begin(*itBegin), end(*itBegin), Rx, Flags)) if(::boost::regex_match(::boost::begin(*itBegin), ::boost::end(*itBegin), Rx, Flags))
{ {
// Add separator // Add separator
detail::insert(Result, end(Result), as_literal(Separator)); detail::insert(Result, ::boost::end(Result), ::boost::as_literal(Separator));
// Add element // Add element
detail::insert(Result, end(Result), *itBegin); detail::insert(Result, ::boost::end(Result), *itBegin);
} }
} }
@@ -634,6 +634,12 @@ namespace boost {
using algorithm::find_all_regex; using algorithm::find_all_regex;
using algorithm::split_regex; using algorithm::split_regex;
#ifndef BOOST_NO_FUNCTION_TEMPLATE_ORDERING
using algorithm::join_if;
#else // BOOST_NO_FUNCTION_TEMPLATE_ORDERING
using algorithm::join_if_regex;
#endif // BOOST_NO_FUNCTION_TEMPLATE_ORDERING
} // namespace boost } // namespace boost

View File

@@ -61,11 +61,11 @@ namespace boost {
range_const_iterator<Range1T>::type>& SearchRange, range_const_iterator<Range1T>::type>& SearchRange,
const Range2T& Format) const Range2T& Format)
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Output, Output,
Input, Input,
range_finder(SearchRange), ::boost::algorithm::range_finder(SearchRange),
const_formatter(Format)); ::boost::algorithm::const_formatter(Format));
} }
//! Replace range algorithm //! Replace range algorithm
@@ -80,10 +80,10 @@ namespace boost {
range_const_iterator<SequenceT>::type>& SearchRange, range_const_iterator<SequenceT>::type>& SearchRange,
const RangeT& Format) const RangeT& Format)
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Input, Input,
range_finder(SearchRange), ::boost::algorithm::range_finder(SearchRange),
const_formatter(Format)); ::boost::algorithm::const_formatter(Format));
} }
//! Replace range algorithm //! Replace range algorithm
@@ -103,10 +103,10 @@ namespace boost {
range_iterator<SequenceT>::type>& SearchRange, range_iterator<SequenceT>::type>& SearchRange,
const RangeT& Format) const RangeT& Format)
{ {
find_format( ::boost::algorithm::find_format(
Input, Input,
range_finder(SearchRange), ::boost::algorithm::range_finder(SearchRange),
const_formatter(Format)); ::boost::algorithm::const_formatter(Format));
} }
// replace_first --------------------------------------------------------------------// // replace_first --------------------------------------------------------------------//
@@ -138,11 +138,11 @@ namespace boost {
const Range2T& Search, const Range2T& Search,
const Range3T& Format) const Range3T& Format)
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Output, Output,
Input, Input,
first_finder(Search), ::boost::algorithm::first_finder(Search),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
//! Replace first algorithm //! Replace first algorithm
@@ -155,10 +155,10 @@ namespace boost {
const Range1T& Search, const Range1T& Search,
const Range2T& Format ) const Range2T& Format )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Input, Input,
first_finder(Search), ::boost::algorithm::first_finder(Search),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
//! Replace first algorithm //! Replace first algorithm
@@ -176,10 +176,10 @@ namespace boost {
const Range1T& Search, const Range1T& Search,
const Range2T& Format ) const Range2T& Format )
{ {
find_format( ::boost::algorithm::find_format(
Input, Input,
first_finder(Search), ::boost::algorithm::first_finder(Search),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
// replace_first ( case insensitive ) ---------------------------------------------// // replace_first ( case insensitive ) ---------------------------------------------//
@@ -214,11 +214,11 @@ namespace boost {
const Range3T& Format, const Range3T& Format,
const std::locale& Loc=std::locale() ) const std::locale& Loc=std::locale() )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Output, Output,
Input, Input,
first_finder(Search, is_iequal(Loc)), ::boost::algorithm::first_finder(Search, is_iequal(Loc)),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
//! Replace first algorithm ( case insensitive ) //! Replace first algorithm ( case insensitive )
@@ -232,10 +232,10 @@ namespace boost {
const Range1T& Format, const Range1T& Format,
const std::locale& Loc=std::locale() ) const std::locale& Loc=std::locale() )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Input, Input,
first_finder(Search, is_iequal(Loc)), ::boost::algorithm::first_finder(Search, is_iequal(Loc)),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
//! Replace first algorithm ( case insensitive ) //! Replace first algorithm ( case insensitive )
@@ -256,10 +256,10 @@ namespace boost {
const Range2T& Format, const Range2T& Format,
const std::locale& Loc=std::locale() ) const std::locale& Loc=std::locale() )
{ {
find_format( ::boost::algorithm::find_format(
Input, Input,
first_finder(Search, is_iequal(Loc)), ::boost::algorithm::first_finder(Search, is_iequal(Loc)),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
// replace_last --------------------------------------------------------------------// // replace_last --------------------------------------------------------------------//
@@ -291,11 +291,11 @@ namespace boost {
const Range2T& Search, const Range2T& Search,
const Range3T& Format ) const Range3T& Format )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Output, Output,
Input, Input,
last_finder(Search), ::boost::algorithm::last_finder(Search),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
//! Replace last algorithm //! Replace last algorithm
@@ -308,10 +308,10 @@ namespace boost {
const Range1T& Search, const Range1T& Search,
const Range2T& Format ) const Range2T& Format )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Input, Input,
last_finder(Search), ::boost::algorithm::last_finder(Search),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
//! Replace last algorithm //! Replace last algorithm
@@ -329,10 +329,10 @@ namespace boost {
const Range1T& Search, const Range1T& Search,
const Range2T& Format ) const Range2T& Format )
{ {
find_format( ::boost::algorithm::find_format(
Input, Input,
last_finder(Search), ::boost::algorithm::last_finder(Search),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
// replace_last ( case insensitive ) -----------------------------------------------// // replace_last ( case insensitive ) -----------------------------------------------//
@@ -367,11 +367,11 @@ namespace boost {
const Range3T& Format, const Range3T& Format,
const std::locale& Loc=std::locale() ) const std::locale& Loc=std::locale() )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Output, Output,
Input, Input,
last_finder(Search, is_iequal(Loc)), ::boost::algorithm::last_finder(Search, is_iequal(Loc)),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
//! Replace last algorithm ( case insensitive ) //! Replace last algorithm ( case insensitive )
@@ -385,10 +385,10 @@ namespace boost {
const Range2T& Format, const Range2T& Format,
const std::locale& Loc=std::locale() ) const std::locale& Loc=std::locale() )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Input, Input,
last_finder(Search, is_iequal(Loc)), ::boost::algorithm::last_finder(Search, is_iequal(Loc)),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
//! Replace last algorithm ( case insensitive ) //! Replace last algorithm ( case insensitive )
@@ -410,10 +410,10 @@ namespace boost {
const Range2T& Format, const Range2T& Format,
const std::locale& Loc=std::locale() ) const std::locale& Loc=std::locale() )
{ {
find_format( ::boost::algorithm::find_format(
Input, Input,
last_finder(Search, is_iequal(Loc)), ::boost::algorithm::last_finder(Search, is_iequal(Loc)),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
// replace_nth --------------------------------------------------------------------// // replace_nth --------------------------------------------------------------------//
@@ -448,11 +448,11 @@ namespace boost {
int Nth, int Nth,
const Range3T& Format ) const Range3T& Format )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Output, Output,
Input, Input,
nth_finder(Search, Nth), ::boost::algorithm::nth_finder(Search, Nth),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
//! Replace nth algorithm //! Replace nth algorithm
@@ -466,10 +466,10 @@ namespace boost {
int Nth, int Nth,
const Range2T& Format ) const Range2T& Format )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Input, Input,
nth_finder(Search, Nth), ::boost::algorithm::nth_finder(Search, Nth),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
//! Replace nth algorithm //! Replace nth algorithm
@@ -490,10 +490,10 @@ namespace boost {
int Nth, int Nth,
const Range2T& Format ) const Range2T& Format )
{ {
find_format( ::boost::algorithm::find_format(
Input, Input,
nth_finder(Search, Nth), ::boost::algorithm::nth_finder(Search, Nth),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
// replace_nth ( case insensitive ) -----------------------------------------------// // replace_nth ( case insensitive ) -----------------------------------------------//
@@ -531,11 +531,11 @@ namespace boost {
const Range3T& Format, const Range3T& Format,
const std::locale& Loc=std::locale() ) const std::locale& Loc=std::locale() )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Output, Output,
Input, Input,
nth_finder(Search, Nth, is_iequal(Loc) ), ::boost::algorithm::nth_finder(Search, Nth, is_iequal(Loc) ),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
//! Replace nth algorithm ( case insensitive ) //! Replace nth algorithm ( case insensitive )
@@ -550,10 +550,10 @@ namespace boost {
const Range2T& Format, const Range2T& Format,
const std::locale& Loc=std::locale() ) const std::locale& Loc=std::locale() )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Input, Input,
nth_finder(Search, Nth, is_iequal(Loc)), ::boost::algorithm::nth_finder(Search, Nth, is_iequal(Loc)),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
//! Replace nth algorithm ( case insensitive ) //! Replace nth algorithm ( case insensitive )
@@ -577,10 +577,10 @@ namespace boost {
const Range2T& Format, const Range2T& Format,
const std::locale& Loc=std::locale() ) const std::locale& Loc=std::locale() )
{ {
find_format( ::boost::algorithm::find_format(
Input, Input,
nth_finder(Search, Nth, is_iequal(Loc)), ::boost::algorithm::nth_finder(Search, Nth, is_iequal(Loc)),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
// replace_all --------------------------------------------------------------------// // replace_all --------------------------------------------------------------------//
@@ -612,11 +612,11 @@ namespace boost {
const Range2T& Search, const Range2T& Search,
const Range3T& Format ) const Range3T& Format )
{ {
return find_format_all_copy( return ::boost::algorithm::find_format_all_copy(
Output, Output,
Input, Input,
first_finder(Search), ::boost::algorithm::first_finder(Search),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
//! Replace all algorithm //! Replace all algorithm
@@ -629,10 +629,10 @@ namespace boost {
const Range1T& Search, const Range1T& Search,
const Range2T& Format ) const Range2T& Format )
{ {
return find_format_all_copy( return ::boost::algorithm::find_format_all_copy(
Input, Input,
first_finder(Search), ::boost::algorithm::first_finder(Search),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
//! Replace all algorithm //! Replace all algorithm
@@ -651,10 +651,10 @@ namespace boost {
const Range1T& Search, const Range1T& Search,
const Range2T& Format ) const Range2T& Format )
{ {
find_format_all( ::boost::algorithm::find_format_all(
Input, Input,
first_finder(Search), ::boost::algorithm::first_finder(Search),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
// replace_all ( case insensitive ) -----------------------------------------------// // replace_all ( case insensitive ) -----------------------------------------------//
@@ -689,11 +689,11 @@ namespace boost {
const Range3T& Format, const Range3T& Format,
const std::locale& Loc=std::locale() ) const std::locale& Loc=std::locale() )
{ {
return find_format_all_copy( return ::boost::algorithm::find_format_all_copy(
Output, Output,
Input, Input,
first_finder(Search, is_iequal(Loc)), ::boost::algorithm::first_finder(Search, is_iequal(Loc)),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
//! Replace all algorithm ( case insensitive ) //! Replace all algorithm ( case insensitive )
@@ -707,10 +707,10 @@ namespace boost {
const Range2T& Format, const Range2T& Format,
const std::locale& Loc=std::locale() ) const std::locale& Loc=std::locale() )
{ {
return find_format_all_copy( return ::boost::algorithm::find_format_all_copy(
Input, Input,
first_finder(Search, is_iequal(Loc)), ::boost::algorithm::first_finder(Search, is_iequal(Loc)),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
//! Replace all algorithm ( case insensitive ) //! Replace all algorithm ( case insensitive )
@@ -731,10 +731,10 @@ namespace boost {
const Range2T& Format, const Range2T& Format,
const std::locale& Loc=std::locale() ) const std::locale& Loc=std::locale() )
{ {
find_format_all( ::boost::algorithm::find_format_all(
Input, Input,
first_finder(Search, is_iequal(Loc)), ::boost::algorithm::first_finder(Search, is_iequal(Loc)),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
// replace_head --------------------------------------------------------------------// // replace_head --------------------------------------------------------------------//
@@ -769,11 +769,11 @@ namespace boost {
int N, int N,
const Range2T& Format ) const Range2T& Format )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Output, Output,
Input, Input,
head_finder(N), ::boost::algorithm::head_finder(N),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
//! Replace head algorithm //! Replace head algorithm
@@ -786,10 +786,10 @@ namespace boost {
int N, int N,
const RangeT& Format ) const RangeT& Format )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Input, Input,
head_finder(N), ::boost::algorithm::head_finder(N),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
//! Replace head algorithm //! Replace head algorithm
@@ -811,10 +811,10 @@ namespace boost {
int N, int N,
const RangeT& Format ) const RangeT& Format )
{ {
find_format( ::boost::algorithm::find_format(
Input, Input,
head_finder(N), ::boost::algorithm::head_finder(N),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
// replace_tail --------------------------------------------------------------------// // replace_tail --------------------------------------------------------------------//
@@ -849,11 +849,11 @@ namespace boost {
int N, int N,
const Range2T& Format ) const Range2T& Format )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Output, Output,
Input, Input,
tail_finder(N), ::boost::algorithm::tail_finder(N),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
//! Replace tail algorithm //! Replace tail algorithm
@@ -866,10 +866,10 @@ namespace boost {
int N, int N,
const RangeT& Format ) const RangeT& Format )
{ {
return find_format_copy( return ::boost::algorithm::find_format_copy(
Input, Input,
tail_finder(N), ::boost::algorithm::tail_finder(N),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
//! Replace tail algorithm //! Replace tail algorithm
@@ -891,10 +891,10 @@ namespace boost {
int N, int N,
const RangeT& Format ) const RangeT& Format )
{ {
find_format( ::boost::algorithm::find_format(
Input, Input,
tail_finder(N), ::boost::algorithm::tail_finder(N),
const_formatter(Format) ); ::boost::algorithm::const_formatter(Format) );
} }
} // namespace algorithm } // namespace algorithm

View File

@@ -64,10 +64,10 @@ namespace boost {
Range1T& Input, Range1T& Input,
const Range2T& Search) const Range2T& Search)
{ {
return iter_find( return ::boost::algorithm::iter_find(
Result, Result,
Input, Input,
first_finder(Search) ); ::boost::algorithm::first_finder(Search) );
} }
//! Find all algorithm ( case insensitive ) //! Find all algorithm ( case insensitive )
@@ -100,10 +100,10 @@ namespace boost {
const Range2T& Search, const Range2T& Search,
const std::locale& Loc=std::locale() ) const std::locale& Loc=std::locale() )
{ {
return iter_find( return ::boost::algorithm::iter_find(
Result, Result,
Input, Input,
first_finder(Search, is_iequal(Loc) ) ); ::boost::algorithm::first_finder(Search, is_iequal(Loc) ) );
} }
@@ -143,10 +143,10 @@ namespace boost {
PredicateT Pred, PredicateT Pred,
token_compress_mode_type eCompress=token_compress_off ) token_compress_mode_type eCompress=token_compress_off )
{ {
return iter_split( return ::boost::algorithm::iter_split(
Result, Result,
Input, Input,
token_finder( Pred, eCompress ) ); ::boost::algorithm::token_finder( Pred, eCompress ) );
} }
} // namespace algorithm } // namespace algorithm

View File

@@ -63,14 +63,14 @@ namespace boost {
const RangeT& Input, const RangeT& Input,
PredicateT IsSpace) PredicateT IsSpace)
{ {
iterator_range<BOOST_STRING_TYPENAME range_const_iterator<RangeT>::type> lit_range(as_literal(Input)); iterator_range<BOOST_STRING_TYPENAME range_const_iterator<RangeT>::type> lit_range(::boost::as_literal(Input));
std::copy( std::copy(
::boost::algorithm::detail::trim_begin( ::boost::algorithm::detail::trim_begin(
begin(lit_range), ::boost::begin(lit_range),
end(lit_range), ::boost::end(lit_range),
IsSpace ), IsSpace ),
end(lit_range), ::boost::end(lit_range),
Output); Output);
return Output; return Output;
@@ -85,10 +85,10 @@ namespace boost {
{ {
return SequenceT( return SequenceT(
::boost::algorithm::detail::trim_begin( ::boost::algorithm::detail::trim_begin(
begin(Input), ::boost::begin(Input),
end(Input), ::boost::end(Input),
IsSpace ), IsSpace ),
end(Input)); ::boost::end(Input));
} }
//! Left trim - parametric //! Left trim - parametric
@@ -106,7 +106,7 @@ namespace boost {
inline SequenceT trim_left_copy(const SequenceT& Input, const std::locale& Loc=std::locale()) inline SequenceT trim_left_copy(const SequenceT& Input, const std::locale& Loc=std::locale())
{ {
return return
trim_left_copy_if( ::boost::algorithm::trim_left_copy_if(
Input, Input,
is_space(Loc)); is_space(Loc));
} }
@@ -124,10 +124,10 @@ namespace boost {
inline void trim_left_if(SequenceT& Input, PredicateT IsSpace) inline void trim_left_if(SequenceT& Input, PredicateT IsSpace)
{ {
Input.erase( Input.erase(
begin(Input), ::boost::begin(Input),
::boost::algorithm::detail::trim_begin( ::boost::algorithm::detail::trim_begin(
begin(Input), ::boost::begin(Input),
end(Input), ::boost::end(Input),
IsSpace)); IsSpace));
} }
@@ -142,7 +142,7 @@ namespace boost {
template<typename SequenceT> template<typename SequenceT>
inline void trim_left(SequenceT& Input, const std::locale& Loc=std::locale()) inline void trim_left(SequenceT& Input, const std::locale& Loc=std::locale())
{ {
trim_left_if( ::boost::algorithm::trim_left_if(
Input, Input,
is_space(Loc)); is_space(Loc));
} }
@@ -171,13 +171,13 @@ namespace boost {
const RangeT& Input, const RangeT& Input,
PredicateT IsSpace ) PredicateT IsSpace )
{ {
iterator_range<BOOST_STRING_TYPENAME range_const_iterator<RangeT>::type> lit_range(as_literal(Input)); iterator_range<BOOST_STRING_TYPENAME range_const_iterator<RangeT>::type> lit_range(::boost::as_literal(Input));
std::copy( std::copy(
begin(lit_range), ::boost::begin(lit_range),
::boost::algorithm::detail::trim_end( ::boost::algorithm::detail::trim_end(
begin(lit_range), ::boost::begin(lit_range),
end(lit_range), ::boost::end(lit_range),
IsSpace ), IsSpace ),
Output ); Output );
@@ -192,10 +192,10 @@ namespace boost {
inline SequenceT trim_right_copy_if(const SequenceT& Input, PredicateT IsSpace) inline SequenceT trim_right_copy_if(const SequenceT& Input, PredicateT IsSpace)
{ {
return SequenceT( return SequenceT(
begin(Input), ::boost::begin(Input),
::boost::algorithm::detail::trim_end( ::boost::algorithm::detail::trim_end(
begin(Input), ::boost::begin(Input),
end(Input), ::boost::end(Input),
IsSpace) IsSpace)
); );
} }
@@ -215,7 +215,7 @@ namespace boost {
inline SequenceT trim_right_copy(const SequenceT& Input, const std::locale& Loc=std::locale()) inline SequenceT trim_right_copy(const SequenceT& Input, const std::locale& Loc=std::locale())
{ {
return return
trim_right_copy_if( ::boost::algorithm::trim_right_copy_if(
Input, Input,
is_space(Loc)); is_space(Loc));
} }
@@ -235,10 +235,10 @@ namespace boost {
{ {
Input.erase( Input.erase(
::boost::algorithm::detail::trim_end( ::boost::algorithm::detail::trim_end(
begin(Input), ::boost::begin(Input),
end(Input), ::boost::end(Input),
IsSpace ), IsSpace ),
end(Input) ::boost::end(Input)
); );
} }
@@ -254,7 +254,7 @@ namespace boost {
template<typename SequenceT> template<typename SequenceT>
inline void trim_right(SequenceT& Input, const std::locale& Loc=std::locale()) inline void trim_right(SequenceT& Input, const std::locale& Loc=std::locale())
{ {
trim_right_if( ::boost::algorithm::trim_right_if(
Input, Input,
is_space(Loc) ); is_space(Loc) );
} }
@@ -283,18 +283,18 @@ namespace boost {
const RangeT& Input, const RangeT& Input,
PredicateT IsSpace) PredicateT IsSpace)
{ {
iterator_range<BOOST_STRING_TYPENAME range_const_iterator<RangeT>::type> lit_range(as_literal(Input)); iterator_range<BOOST_STRING_TYPENAME range_const_iterator<RangeT>::type> lit_range(::boost::as_literal(Input));
BOOST_STRING_TYPENAME BOOST_STRING_TYPENAME
range_const_iterator<RangeT>::type TrimEnd= range_const_iterator<RangeT>::type TrimEnd=
::boost::algorithm::detail::trim_end( ::boost::algorithm::detail::trim_end(
begin(lit_range), ::boost::begin(lit_range),
end(lit_range), ::boost::end(lit_range),
IsSpace); IsSpace);
std::copy( std::copy(
detail::trim_begin( detail::trim_begin(
begin(lit_range), TrimEnd, IsSpace), ::boost::begin(lit_range), TrimEnd, IsSpace),
TrimEnd, TrimEnd,
Output Output
); );
@@ -312,13 +312,13 @@ namespace boost {
BOOST_STRING_TYPENAME BOOST_STRING_TYPENAME
range_const_iterator<SequenceT>::type TrimEnd= range_const_iterator<SequenceT>::type TrimEnd=
::boost::algorithm::detail::trim_end( ::boost::algorithm::detail::trim_end(
begin(Input), ::boost::begin(Input),
end(Input), ::boost::end(Input),
IsSpace); IsSpace);
return SequenceT( return SequenceT(
detail::trim_begin( detail::trim_begin(
begin(Input), ::boost::begin(Input),
TrimEnd, TrimEnd,
IsSpace), IsSpace),
TrimEnd TrimEnd
@@ -340,7 +340,7 @@ namespace boost {
inline SequenceT trim_copy( const SequenceT& Input, const std::locale& Loc=std::locale() ) inline SequenceT trim_copy( const SequenceT& Input, const std::locale& Loc=std::locale() )
{ {
return return
trim_copy_if( ::boost::algorithm::trim_copy_if(
Input, Input,
is_space(Loc) ); is_space(Loc) );
} }
@@ -357,8 +357,8 @@ namespace boost {
template<typename SequenceT, typename PredicateT> template<typename SequenceT, typename PredicateT>
inline void trim_if(SequenceT& Input, PredicateT IsSpace) inline void trim_if(SequenceT& Input, PredicateT IsSpace)
{ {
trim_right_if( Input, IsSpace ); ::boost::algorithm::trim_right_if( Input, IsSpace );
trim_left_if( Input, IsSpace ); ::boost::algorithm::trim_left_if( Input, IsSpace );
} }
//! Trim //! Trim
@@ -372,7 +372,7 @@ namespace boost {
template<typename SequenceT> template<typename SequenceT>
inline void trim(SequenceT& Input, const std::locale& Loc=std::locale()) inline void trim(SequenceT& Input, const std::locale& Loc=std::locale())
{ {
trim_if( ::boost::algorithm::trim_if(
Input, Input,
is_space( Loc ) ); is_space( Loc ) );
} }

View File

@@ -0,0 +1,217 @@
// Boost string_algo library trim.hpp header file ---------------------------//
// Copyright Pavol Droba 2002-2003.
//
// Distributed under the Boost Software License, Version 1.0.
// (See accompanying file LICENSE_1_0.txt or copy at
// http://www.boost.org/LICENSE_1_0.txt)
// See http://www.boost.org/ for updates, documentation, and revision history.
#ifndef BOOST_STRING_TRIM_ALL_HPP
#define BOOST_STRING_TRIM_ALL_HPP
#include <boost/algorithm/string/config.hpp>
#include <boost/algorithm/string/trim.hpp>
#include <boost/algorithm/string/classification.hpp>
#include <boost/algorithm/string/find_format.hpp>
#include <boost/algorithm/string/formatter.hpp>
#include <boost/algorithm/string/finder.hpp>
#include <locale>
/*! \file
Defines trim_all algorithms.
Just like \c trim, \c trim_all removes all trailing and leading spaces from a
sequence (string). In addition, spaces in the middle of the sequence are truncated
to just one character. Space is recognized using given locales.
\c trim_fill acts as trim_all, but the spaces in the middle are replaces with
a user-define sequence of character.
Parametric (\c _if) variants use a predicate (functor) to select which characters
are to be trimmed..
Functions take a selection predicate as a parameter, which is used to determine
whether a character is a space. Common predicates are provided in classification.hpp header.
*/
namespace boost {
namespace algorithm {
// multi line trim ----------------------------------------------- //
//! Trim All - parametric
/*!
Remove all leading and trailing spaces from the input and
compress all other spaces to a single character.
The result is a trimmed copy of the input
\param Input An input sequence
\param IsSpace An unary predicate identifying spaces
\return A trimmed copy of the input
*/
template<typename SequenceT, typename PredicateT>
inline SequenceT trim_all_copy_if(const SequenceT& Input, PredicateT IsSpace)
{
return
::boost::find_format_all_copy(
::boost::trim_copy_if(Input, IsSpace),
::boost::token_finder(IsSpace, ::boost::token_compress_on),
::boost::dissect_formatter(::boost::head_finder(1)));
}
//! Trim All
/*!
Remove all leading and trailing spaces from the input and
compress all other spaces to a single character.
The input sequence is modified in-place.
\param Input An input sequence
\param IsSpace An unary predicate identifying spaces
*/
template<typename SequenceT, typename PredicateT>
inline void trim_all_if(SequenceT& Input, PredicateT IsSpace)
{
::boost::trim_if(Input, IsSpace);
::boost::find_format_all(
Input,
::boost::token_finder(IsSpace, ::boost::token_compress_on),
::boost::dissect_formatter(::boost::head_finder(1)));
}
//! Trim All
/*!
Remove all leading and trailing spaces from the input and
compress all other spaces to a single character.
The result is a trimmed copy of the input
\param Input An input sequence
\param Loc A locale used for 'space' classification
\return A trimmed copy of the input
*/
template<typename SequenceT>
inline SequenceT trim_all_copy(const SequenceT& Input, const std::locale& Loc =std::locale())
{
return trim_all_copy_if(Input, ::boost::is_space(Loc));
}
//! Trim All
/*!
Remove all leading and trailing spaces from the input and
compress all other spaces to a single character.
The input sequence is modified in-place.
\param Input An input sequence
\param Loc A locale used for 'space' classification
\return A trimmed copy of the input
*/
template<typename SequenceT>
inline void trim_all(SequenceT& Input, const std::locale& Loc =std::locale())
{
trim_all_if(Input, ::boost::is_space(Loc));
}
//! Trim Fill - parametric
/*!
Remove all leading and trailing spaces from the input and
replace all every block of consecutive spaces with a fill string
defined by user.
The result is a trimmed copy of the input
\param Input An input sequence
\param Fill A string used to fill the inner spaces
\param IsSpace An unary predicate identifying spaces
\return A trimmed copy of the input
*/
template<typename SequenceT, typename RangeT, typename PredicateT>
inline SequenceT trim_fill_copy_if(const SequenceT& Input, const RangeT& Fill, PredicateT IsSpace)
{
return
::boost::find_format_all_copy(
::boost::trim_copy_if(Input, IsSpace),
::boost::token_finder(IsSpace, ::boost::token_compress_on),
::boost::const_formatter(::boost::as_literal(Fill)));
}
//! Trim Fill
/*!
Remove all leading and trailing spaces from the input and
replace all every block of consecutive spaces with a fill string
defined by user.
The input sequence is modified in-place.
\param Input An input sequence
\param Fill A string used to fill the inner spaces
\param IsSpace An unary predicate identifying spaces
*/
template<typename SequenceT, typename RangeT, typename PredicateT>
inline void trim_fill_if(SequenceT& Input, const RangeT& Fill, PredicateT IsSpace)
{
::boost::trim_if(Input, IsSpace);
::boost::find_format_all(
Input,
::boost::token_finder(IsSpace, ::boost::token_compress_on),
::boost::const_formatter(::boost::as_literal(Fill)));
}
//! Trim Fill
/*!
Remove all leading and trailing spaces from the input and
replace all every block of consecutive spaces with a fill string
defined by user.
The result is a trimmed copy of the input
\param Input An input sequence
\param Fill A string used to fill the inner spaces
\param Loc A locale used for 'space' classification
\return A trimmed copy of the input
*/
template<typename SequenceT, typename RangeT>
inline SequenceT trim_fill_copy(const SequenceT& Input, const RangeT& Fill, const std::locale& Loc =std::locale())
{
return trim_fill_copy_if(Input, Fill, ::boost::is_space(Loc));
}
//! Trim Fill
/*!
Remove all leading and trailing spaces from the input and
replace all every block of consecutive spaces with a fill string
defined by user.
The input sequence is modified in-place.
\param Input An input sequence
\param Fill A string used to fill the inner spaces
\param Loc A locale used for 'space' classification
\return A trimmed copy of the input
*/
template<typename SequenceT, typename RangeT>
inline void trim_fill(SequenceT& Input, const RangeT& Fill, const std::locale& Loc =std::locale())
{
trim_fill_if(Input, Fill, ::boost::is_space(Loc));
}
} // namespace algorithm
// pull names to the boost namespace
using algorithm::trim_all;
using algorithm::trim_all_if;
using algorithm::trim_all_copy;
using algorithm::trim_all_copy_if;
using algorithm::trim_fill;
using algorithm::trim_fill_if;
using algorithm::trim_fill_copy;
using algorithm::trim_fill_copy_if;
} // namespace boost
#endif // BOOST_STRING_TRIM_ALL_HPP

View File

@@ -56,7 +56,7 @@ be enough. The present library solves both problems.</p>
<tt>minmax</tt> <tt>minmax</tt>
as straightforward extensions of the C++ as straightforward extensions of the C++
standard. As it returns a pair of <tt>const&amp;</tt>, we must use the <a standard. As it returns a pair of <tt>const&amp;</tt>, we must use the <a
href=:../../../../tuple/index.html>Boost.tuple</a> library to construct such href="../../tuple/index.html">Boost.tuple</a> library to construct such
pairs. (Please note: the intent is not to fix the known defaults of pairs. (Please note: the intent is not to fix the known defaults of
<tt>std::min</tt> <tt>std::min</tt>
and <tt>std::max</tt>, but to add one more algorithms that combines both; see the and <tt>std::max</tt>, but to add one more algorithms that combines both; see the
@@ -92,11 +92,11 @@ Synopsis of <tt>&lt;boost/algorithm/minmax.hpp></tt></h3>
namespace boost { namespace boost {
template &lt;class T> template &lt;class T>
tuple&lt;T const&amp;, T const&amp;> > tuple&lt;T const&amp;, T const&amp;>
minmax(const T&amp; a, const T&amp; b); minmax(const T&amp; a, const T&amp; b);
template &lt;class T, class <a href="http://www.sgi.com/tech/stl/BinaryPredicate.html">BinaryPredicate</a>> template &lt;class T, class <a href="http://www.sgi.com/tech/stl/BinaryPredicate.html">BinaryPredicate</a>>
tuple&lt;T const&amp;, T const&amp;> > tuple&lt;T const&amp;, T const&amp;>
minmax(const T&amp; a, const T&amp; b, BinaryPredicate comp); minmax(const T&amp; a, const T&amp; b, BinaryPredicate comp);
} }
@@ -158,9 +158,9 @@ identical to
that they return the last instance of the largest element (and not the that they return the last instance of the largest element (and not the
first, as <tt>first_min_element</tt> and <tt>last_max_element</tt> would). first, as <tt>first_min_element</tt> and <tt>last_max_element</tt> would).
<p>The family of algorithms comprising <tt>first_min_first_max_element</tt>, <p>The family of algorithms comprising <tt>first_min_first_max_element</tt>,
<tt>first_min_first_max_element</tt>, <tt>first_min_last_max_element</tt>,
<tt>first_min_first_max_element</tt>, <tt>last_min_first_max_element</tt>,
and <tt>first_min_first_max_element</tt> can be described generically as and <tt>last_min_last_max_element</tt> can be described generically as
follows (using <i><tt>which</tt></i> and follows (using <i><tt>which</tt></i> and
<i><tt>what</tt></i> for <tt>first</tt> <i><tt>what</tt></i> for <tt>first</tt>
or <tt>last</tt>): <tt><i>which</i>_min_<i>what</i>_max_element</tt> finds or <tt>last</tt>): <tt><i>which</i>_min_<i>what</i>_max_element</tt> finds
@@ -243,7 +243,7 @@ range
<a name="complexity"> <a name="complexity">
<h3> <h3>
<a NAME="Complexity"></a>Complexity</h3> Complexity</h3>
Minmax performs a single comparison and is otherwise of constant complexity. Minmax performs a single comparison and is otherwise of constant complexity.
The use of <tt>boost::tuple&lt;T const&amp;></tt> prevents copy The use of <tt>boost::tuple&lt;T const&amp;></tt> prevents copy
constructors in case the arguments are passed by reference. constructors in case the arguments are passed by reference.
@@ -338,7 +338,7 @@ most</i> instead of <i>exactly</i> in the odd case.
<b>Rationale:</b></h3> <b>Rationale:</b></h3>
<a name="two_headers"> <a name="two_headers">
<h4><b>Why not a single header <tt>&amp;boost/algorithm/minmax.hpp></tt>?</b></h4> <h4><b>Why not a single header <tt>&lt;boost/algorithm/minmax.hpp></tt>?</b></h4>
<p>This was the design originally proposed and approved in the formal <p>This was the design originally proposed and approved in the formal
review. As the need for Boost.tuple became clear (due to the limitations review. As the need for Boost.tuple became clear (due to the limitations
of <tt>std::pair</tt>), it became also annoying to require another of <tt>std::pair</tt>), it became also annoying to require another
@@ -438,7 +438,7 @@ comparisons).</p>
slower than slower than
<tt>first_min_element</tt> alone, still much less than <tt>first_min_element</tt> <tt>first_min_element</tt> alone, still much less than <tt>first_min_element</tt>
and and
<tt>last_max_element</tt> called separately. <a href="#Performance">[2]</a> <tt>last_max_element</tt> called separately. <a href="#Note2">[2]</a>
<h4><b>Why algorithms and not accumulators?</b></h4> <h4><b>Why algorithms and not accumulators?</b></h4>
<p>The minmax algorithms are useful in computing the extent of a range. <p>The minmax algorithms are useful in computing the extent of a range.

View File

@@ -54,23 +54,23 @@ void test(BOOST_EXPLICIT_TEMPLATE_TYPE(Value))
less_count<Value> lc(counter); less_count<Value> lc(counter);
// Test functionality // Test functionality
tuple<Value const&, Value const&> result1 = minmax(zero, one); tuple<Value const&, Value const&> result1 = boost::minmax(zero, one);
BOOST_CHECK_EQUAL( get<0>(result1), zero ); BOOST_CHECK_EQUAL( get<0>(result1), zero );
BOOST_CHECK_EQUAL( get<1>(result1), one ); BOOST_CHECK_EQUAL( get<1>(result1), one );
tuple<Value const&, Value const&> result2 = minmax(one, zero); tuple<Value const&, Value const&> result2 = boost::minmax(one, zero);
BOOST_CHECK_EQUAL( get<0>(result2), zero ); BOOST_CHECK_EQUAL( get<0>(result2), zero );
BOOST_CHECK_EQUAL( get<1>(result2), one ); BOOST_CHECK_EQUAL( get<1>(result2), one );
// Test functionality and number of comparisons // Test functionality and number of comparisons
lc.reset(); lc.reset();
tuple<Value const&, Value const&> result3 = minmax(zero, one, lc ); tuple<Value const&, Value const&> result3 = boost::minmax(zero, one, lc );
BOOST_CHECK_EQUAL( get<0>(result3), zero ); BOOST_CHECK_EQUAL( get<0>(result3), zero );
BOOST_CHECK_EQUAL( get<1>(result3), one ); BOOST_CHECK_EQUAL( get<1>(result3), one );
BOOST_CHECK_EQUAL( counter, 1 ); BOOST_CHECK_EQUAL( counter, 1 );
lc.reset(); lc.reset();
tuple<Value const&, Value const&> result4 = minmax(one, zero, lc ); tuple<Value const&, Value const&> result4 = boost::minmax(one, zero, lc );
BOOST_CHECK_EQUAL( get<0>(result4), zero ); BOOST_CHECK_EQUAL( get<0>(result4), zero );
BOOST_CHECK_EQUAL( get<1>(result4), one ); BOOST_CHECK_EQUAL( get<1>(result4), one );
BOOST_CHECK_EQUAL( counter, 1); BOOST_CHECK_EQUAL( counter, 1);

View File

@@ -10,7 +10,11 @@
import toolset ; import toolset ;
toolset.using doxygen ; toolset.using doxygen ;
boostbook string_algo : string_algo.xml autodoc ; boostbook string_algo : string_algo.xml autodoc
:
<xsl:param>boost.root=../../../../..
<format>pdf:<xsl:param>boost.url.prefix=http://www.boost.org/doc/libs/release/doc/html
;
doxygen autodoc doxygen autodoc
: :
@@ -31,6 +35,7 @@ doxygen autodoc
[ glob ../../../../boost/algorithm/string/trim.hpp ] [ glob ../../../../boost/algorithm/string/trim.hpp ]
[ glob ../../../../boost/algorithm/string/predicate.hpp ] [ glob ../../../../boost/algorithm/string/predicate.hpp ]
[ glob ../../../../boost/algorithm/string/split.hpp ] [ glob ../../../../boost/algorithm/string/split.hpp ]
[ glob ../../../../boost/algorithm/string/iter_find.hpp ]
[ glob ../../../../boost/algorithm/string/erase.hpp ] [ glob ../../../../boost/algorithm/string/erase.hpp ]
[ glob ../../../../boost/algorithm/string/join.hpp ] [ glob ../../../../boost/algorithm/string/join.hpp ]
[ glob ../../../../boost/algorithm/string/replace.hpp ] [ glob ../../../../boost/algorithm/string/replace.hpp ]
@@ -38,6 +43,7 @@ doxygen autodoc
[ glob ../../../../boost/algorithm/string/formatter.hpp ] [ glob ../../../../boost/algorithm/string/formatter.hpp ]
[ glob ../../../../boost/algorithm/string/regex.hpp ] [ glob ../../../../boost/algorithm/string/regex.hpp ]
[ glob ../../../../boost/algorithm/string/regex_find_format.hpp ] [ glob ../../../../boost/algorithm/string/regex_find_format.hpp ]
[ glob ../../../../boost/algorithm/string/trim_all.hpp ]
: :
<doxygen:param>HIDE_UNDOC_MEMBERS=YES <doxygen:param>HIDE_UNDOC_MEMBERS=YES
<doxygen:param>EXTRACT_PRIVATE=NO <doxygen:param>EXTRACT_PRIVATE=NO

View File

@@ -4,7 +4,7 @@
<!-- Copyright (c) 2002-2006 Pavol Droba. <!-- Copyright (c) 2002-2006 Pavol Droba.
Subject to the Boost Software License, Version 1.0. Subject to the Boost Software License, Version 1.0.
(See accompanying file LICENSE-1.0 or http://www.boost.org/LICENSE-1.0) (See accompanying file LICENSE_1_0.txt or http://www.boost.org/LICENSE_1_0.txt)
--> -->
<section id="string_algo.concept" last-revision="$Date$"> <section id="string_algo.concept" last-revision="$Date$">
@@ -102,7 +102,7 @@
struct simple_finder struct simple_finder
{ {
template&lt;typename ForwardIteratorT&gt; template&lt;typename ForwardIteratorT&gt;
boost::iterator_range&lt;ForwardIterator&gt; operator()( boost::iterator_range&lt;ForwardIteratorT&gt; operator()(
ForwardIteratorT Begin, ForwardIteratorT Begin,
ForwardIteratorT End ) ForwardIteratorT End )
{ {

View File

@@ -4,7 +4,7 @@
<!-- Copyright (c) 2002-2006 Pavol Droba. <!-- Copyright (c) 2002-2006 Pavol Droba.
Subject to the Boost Software License, Version 1.0. Subject to the Boost Software License, Version 1.0.
(See accompanying file LICENSE-1.0 or http://www.boost.org/LICENSE-1.0) (See accompanying file LICENSE_1_0.txt or http://www.boost.org/LICENSE_1_0.txt)
--> -->
<section id="string_algo.credits" last-revision="$Date$"> <section id="string_algo.credits" last-revision="$Date$">

View File

@@ -5,7 +5,7 @@
<!-- Copyright (c) 2002-2006 Pavol Droba. <!-- Copyright (c) 2002-2006 Pavol Droba.
Subject to the Boost Software License, Version 1.0. Subject to the Boost Software License, Version 1.0.
(See accompanying file LICENSE-1.0 or http://www.boost.org/LICENSE-1.0) (See accompanying file LICENSE_1_0.txt or http://www.boost.org/LICENSE_1_0.txt)
--> -->
<section id="string_algo.design" last-revision="$Date$"> <section id="string_algo.design" last-revision="$Date$">
@@ -25,7 +25,7 @@
</para> </para>
<para> <para>
<emphasis role="bold">Definition:</emphasis> A string is a <emphasis role="bold">Definition:</emphasis> A string is a
<ulink url="../../libs/range/doc/range.html">range</ulink> of characters accessible in sequential <ulink url="../../libs/range/index.html">range</ulink> of characters accessible in sequential
ordered fashion. Character is any value type with "cheap" copying and assignment. ordered fashion. Character is any value type with "cheap" copying and assignment.
</para> </para>
<para> <para>
@@ -217,7 +217,7 @@
</para> </para>
<para> <para>
For more information about the exception safety topics, follow this For more information about the exception safety topics, follow this
<ulink url="../../more/generic_exception_safety.html">link</ulink> <ulink url="http://www.boost.org/more/generic_exception_safety.html">link</ulink>
</para> </para>
</section> </section>
</section> </section>

View File

@@ -4,7 +4,7 @@
<!-- Copyright (c) 2002-2006 Pavol Droba. <!-- Copyright (c) 2002-2006 Pavol Droba.
Subject to the Boost Software License, Version 1.0. Subject to the Boost Software License, Version 1.0.
(See accompanying file LICENSE-1.0 or http://www.boost.org/LICENSE-1.0) (See accompanying file LICENSE_1_0.txt or http://www.boost.org/LICENSE_1_0.txt)
--> -->
<section id="string_algo.env" last-revision="$Date$"> <section id="string_algo.env" last-revision="$Date$">

View File

@@ -32,7 +32,9 @@
free-standing functions and type-generators exists:</p><code>void foo( const T&, int ); <br> free-standing functions and type-generators exists:</p><code>void foo( const T&, int ); <br>
int bar( T& ); <br> int bar( T& ); <br>
foo_type_of< T >::type;</code> <br> <br><hr size="1" ><h3 >Literature</h3><ul ><li > <a href="http://www.boost.org/more/generic_programming.html#type_generator" target="_self" >Type Generators</a> </li><li > <a href="http://www.boost.org/more/generic_programming.html#concept" target="_self" >Concepts</a> </li><li > <a href="http://www.sgi.com/tech/stl/stl_introduction.html" target="_self" >Concepts and SGI STL</a> </li></ul><hr size="1" ><p >&copy; Thorsten Ottosen 2003-2004 (nesotto_AT_cs.auc.dk). foo_type_of< T >::type;</code> <br> <br><hr size="1" ><h3 >Literature</h3><ul ><li > <a href="http://www.boost.org/more/generic_programming.html#type_generator" target="_self" >Type Generators</a> </li><li > <a href="http://www.boost.org/more/generic_programming.html#concept" target="_self" >Concepts</a> </li><li > <a href="http://www.sgi.com/tech/stl/stl_introduction.html" target="_self" >Concepts and SGI STL</a> </li></ul><hr size="1" ><p >&copy; Thorsten Ottosen 2003-2004 (nesotto_AT_cs.auc.dk).
Permission to copy, use, modify, sell and distribute this software is granted provided this copyright notice appears <br>Use, modification and distribution is subject to the Boost
in all copies. This software is provided "as is" without express or implied warranty, and with no Software License, Version 1.0. (See accompanying file
claim as to its suitability for any purpose.</p><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br></body></html> <code class="filename">LICENSE_1_0.txt</code> or copy at <a href="http://www.boost.org/LICENSE_1_0.txt" target="_top">http://www.boost.org/LICENSE_1_0.txt</a>)
<!-- Copyright Dezide Aps 2003-2004 --> </br>
</p>
<!-- Copyright Dezide Aps 2003-2004 -->

View File

@@ -5,7 +5,7 @@
<!-- Copyright (c) 2002-2006 Pavol Droba. <!-- Copyright (c) 2002-2006 Pavol Droba.
Subject to the Boost Software License, Version 1.0. Subject to the Boost Software License, Version 1.0.
(See accompanying file LICENSE-1.0 or http://www.boost.org/LICENSE-1.0) (See accompanying file LICENSE_1_0.txt or http://www.boost.org/LICENSE_1_0.txt)
--> -->
<section id="string_algo.intro" last-revision="$Date$"> <section id="string_algo.intro" last-revision="$Date$">

View File

@@ -4,7 +4,7 @@
<!-- Copyright (c) 2002-2006 Pavol Droba. <!-- Copyright (c) 2002-2006 Pavol Droba.
Subject to the Boost Software License, Version 1.0. Subject to the Boost Software License, Version 1.0.
(See accompanying file LICENSE-1.0 or http://www.boost.org/LICENSE-1.0) (See accompanying file LICENSE_1_0.txt or http://www.boost.org/LICENSE_1_0.txt)
--> -->
<section id="string_algo.quickref" last-revision="$Date$"> <section id="string_algo.quickref" last-revision="$Date$">
@@ -151,7 +151,7 @@
</row> </row>
<row> <row>
<entry><code>lexicographical_compare</code></entry> <entry><code>lexicographical_compare</code></entry>
<entry>Check if a string is lexicographicaly less then another one</entry> <entry>Check if a string is lexicographically less then another one</entry>
<entry> <entry>
<functionname>lexicographical_compare()</functionname> <functionname>lexicographical_compare()</functionname>
<sbr/> <sbr/>
@@ -434,7 +434,7 @@
<functionname>find_all_regex()</functionname> <functionname>find_all_regex()</functionname>
</entry> </entry>
</row> </row>
<row> <row>
<entry>split</entry> <entry>split</entry>
<entry>Split input into parts</entry> <entry>Split input into parts</entry>
<entry> <entry>
@@ -442,7 +442,21 @@
<sbr/> <sbr/>
<functionname>split_regex()</functionname> <functionname>split_regex()</functionname>
</entry> </entry>
</row> </row>
<row>
<entry>iter_find</entry>
<entry>Iteratively apply the finder to the input to find all matching substrings</entry>
<entry>
<functionname>iter_find()</functionname>
</entry>
</row>
<row>
<entry>iter_split</entry>
<entry>Use the finder to find matching substrings in the input and use them as separators to split the input into parts</entry>
<entry>
<functionname>iter_split()</functionname>
</entry>
</row>
</tbody> </tbody>
</tgroup> </tgroup>
</table> </table>
@@ -723,6 +737,20 @@
<functionname>is_xdigit()</functionname> <functionname>is_xdigit()</functionname>
</entry> </entry>
</row> </row>
<row>
<entry>is_any_of</entry>
<entry>Recognize any of a sequence of characters</entry>
<entry>
<functionname>is_any_of()</functionname>
</entry>
</row>
<row>
<entry>is_from_range</entry>
<entry>Recognize characters inside a min..max range</entry>
<entry>
<functionname>is_from_range()</functionname>
</entry>
</row>
</tbody> </tbody>
</tgroup> </tgroup>
</table> </table>

View File

@@ -4,7 +4,7 @@
<!-- Copyright (c) 2002-2006 Pavol Droba. <!-- Copyright (c) 2002-2006 Pavol Droba.
Subject to the Boost Software License, Version 1.0. Subject to the Boost Software License, Version 1.0.
(See accompanying file LICENSE-1.0 or http://www.boost.org/LICENSE-1.0) (See accompanying file LICENSE_1_0.txt or http://www.boost.org/LICENSE_1_0.txt)
--> -->
<section id="string_algo.rationale" last-revision="$Date$"> <section id="string_algo.rationale" last-revision="$Date$">

View File

@@ -4,10 +4,14 @@
<!-- Copyright (c) 2002-2006 Pavol Droba. <!-- Copyright (c) 2002-2006 Pavol Droba.
Subject to the Boost Software License, Version 1.0. Subject to the Boost Software License, Version 1.0.
(See accompanying file LICENSE-1.0 or http://www.boost.org/LICENSE-1.0) (See accompanying file LICENSE_1_0.txt or http://www.boost.org/LICENSE_1_0.txt)
--> -->
<section id="string_algo.release_notes" last-revision="$Date$"> <section id="string_algo.release_notes" last-revision="$Date$">
<using-namespace name="boost"/>
<using-namespace name="boost::algorithm"/>
<title>Release Notes</title> <title>Release Notes</title>
<itemizedlist> <itemizedlist>
@@ -19,5 +23,23 @@
<para><emphasis role="bold">1.33</emphasis></para> <para><emphasis role="bold">1.33</emphasis></para>
<para>Internal version of collection traits removed, library adapted to Boost.Range</para> <para>Internal version of collection traits removed, library adapted to Boost.Range</para>
</listitem> </listitem>
<listitem>
<para><emphasis role="bold">1.34</emphasis></para>
<itemizedlist>
<listitem>
<functionname>lexicographical_compare()</functionname>
</listitem>
<listitem>
<functionname>join()</functionname> and <functionname>join_if()</functionname>
</listitem>
<listitem>
New comparison predicates <code>is_less</code>, <code>is_not_greater</code>
</listitem>
<listitem>
Negative indexes support (like Perl) in various algorihtms
(<code>*_head/tail</code>, <code>*_nth</code>).
</listitem>
</itemizedlist>
</listitem>
</itemizedlist> </itemizedlist>
</section> </section>

View File

@@ -4,7 +4,7 @@
<!-- Copyright (c) 2002-2006 Pavol Droba. <!-- Copyright (c) 2002-2006 Pavol Droba.
Subject to the Boost Software License, Version 1.0. Subject to the Boost Software License, Version 1.0.
(See accompanying file LICENSE-1.0 or http://www.boost.org/LICENSE-1.0) (See accompanying file LICENSE_1_0.txt or http://www.boost.org/LICENSE_1_0.txt)
--> -->
<library name="String Algorithms" dirname="algorithm/string" xmlns:xi="http://www.w3.org/2001/XInclude" <library name="String Algorithms" dirname="algorithm/string" xmlns:xi="http://www.w3.org/2001/XInclude"
@@ -33,7 +33,7 @@
<librarypurpose> <librarypurpose>
A set of generic string-related algorithms and utilities A set of generic string-related algorithms and utilities
</librarypurpose> </librarypurpose>
<librarycategory name="category:algoritms"/> <librarycategory name="category:algorithms"/>
<librarycategory name="category:string-text"/> <librarycategory name="category:string-text"/>
</libraryinfo> </libraryinfo>

View File

@@ -5,7 +5,7 @@
<!-- Copyright (c) 2002-2006 Pavol Droba. <!-- Copyright (c) 2002-2006 Pavol Droba.
Subject to the Boost Software License, Version 1.0. Subject to the Boost Software License, Version 1.0.
(See accompanying file LICENSE-1.0 or http://www.boost.org/LICENSE-1.0) (See accompanying file LICENSE_1_0.txt or http://www.boost.org/LICENSE_1_0.txt)
--> -->
@@ -57,7 +57,7 @@
The magic of <ulink url="../../libs/range/index.html">Boost.Range</ulink> The magic of <ulink url="../../libs/range/index.html">Boost.Range</ulink>
provides a uniform way of handling different string types. provides a uniform way of handling different string types.
If there is a need to pass a pair of iterators, If there is a need to pass a pair of iterators,
<ulink url="../../libs/range/doc/utility_class.html"><code>boost::iterator_range</code></ulink> <ulink url="../../libs/range/doc/html/range/reference/utilities/iterator_range.html"><code>boost::iterator_range</code></ulink>
can be used to package iterators into a structure with a compatible interface. can be used to package iterators into a structure with a compatible interface.
</para> </para>
</listitem> </listitem>
@@ -130,7 +130,7 @@
string str1("command.com"); string str1("command.com");
cout cout
&lt;&lt; str1 &lt;&lt; str1
&lt;&lt; is_executable("command.com")? "is": "is not" &lt;&lt; (is_executable("command.com")? "is": "is not")
&lt;&lt; "an executable" &lt;&lt; "an executable"
&lt;&lt; endl; // prints "command.com is an executable" &lt;&lt; endl; // prints "command.com is an executable"
@@ -138,7 +138,7 @@
char text1[]="hello world!"; char text1[]="hello world!";
cout cout
&lt;&lt; text1 &lt;&lt; text1
&lt;&lt; all( text1, is_lower() )? "is": "is not" &lt;&lt; (all( text1, is_lower() )? "is": "is not")
&lt;&lt; " written in the lower case" &lt;&lt; " written in the lower case"
&lt;&lt; endl; // prints "hello world! is written in the lower case" &lt;&lt; endl; // prints "hello world! is written in the lower case"
</programlisting> </programlisting>
@@ -169,7 +169,7 @@
<programlisting> <programlisting>
string str1=" hello world! "; string str1=" hello world! ";
string str2=trim_left_copy(str1); // str2 == "hello world! " string str2=trim_left_copy(str1); // str2 == "hello world! "
string str3=trim_right_copy(str2); // str3 == " hello world!" string str3=trim_right_copy(str1); // str3 == " hello world!"
trim(str1); // str1 == "hello world!" trim(str1); // str1 == "hello world!"
string phone="00423333444"; string phone="00423333444";
@@ -208,7 +208,7 @@
</programlisting> </programlisting>
<para> <para>
We have used <functionname>find_last()</functionname> to search the <code>text</code> for "ll". We have used <functionname>find_last()</functionname> to search the <code>text</code> for "ll".
The result is given in the <ulink url="../../libs/range/doc/utility_class.html"><code>boost::iterator_range</code></ulink>. The result is given in the <ulink url="../../libs/range/doc/html/range/reference/utilities/iterator_range.html"><code>boost::iterator_range</code></ulink>.
This range delimits the This range delimits the
part of the input which satisfies the find criteria. In our example it is the last occurrence of "ll". part of the input which satisfies the find criteria. In our example it is the last occurrence of "ll".
@@ -217,7 +217,7 @@
<ulink url="../../libs/range/index.html">Boost.Range</ulink>. <ulink url="../../libs/range/index.html">Boost.Range</ulink>.
The following lines transform the result. Notice that The following lines transform the result. Notice that
<ulink url="../../libs/range/doc/utility_class.html"><code>boost::iterator_range</code></ulink> has familiar <ulink url="../../libs/range/doc/html/range/reference/utilities/iterator_range.html"><code>boost::iterator_range</code></ulink> has familiar
<code>begin()</code> and <code>end()</code> methods, so it can be used like any other STL container. <code>begin()</code> and <code>end()</code> methods, so it can be used like any other STL container.
Also it is convertible to bool therefore it is easy to use find algorithms for a simple containment checking. Also it is convertible to bool therefore it is easy to use find algorithms for a simple containment checking.
</para> </para>
@@ -264,7 +264,7 @@
the find iterator allows us to iterate over the substrings matching the specified criteria. the find iterator allows us to iterate over the substrings matching the specified criteria.
This facility is using the <link linkend="string_algo.finder_concept">Finder</link> to incrementally This facility is using the <link linkend="string_algo.finder_concept">Finder</link> to incrementally
search the string. search the string.
Dereferencing a find iterator yields an <ulink url="../../libs/range/doc/utility_class.html"><code>boost::iterator_range</code></ulink> Dereferencing a find iterator yields an <ulink url="../../libs/range/doc/html/range/reference/utilities/iterator_range.html"><code>boost::iterator_range</code></ulink>
object, that delimits the current match. object, that delimits the current match.
</para> </para>
<para> <para>
@@ -339,7 +339,7 @@
typedef vector&lt; string &gt; split_vector_type; typedef vector&lt; string &gt; split_vector_type;
split_vector_type SplitVec; // #2: Search for tokens split_vector_type SplitVec; // #2: Search for tokens
split( SplitVec, str1, is_any_of("-*") ); // SplitVec == { "hello abc","ABC","aBc goodbye" } split( SplitVec, str1, is_any_of("-*"), token_compress_on ); // SplitVec == { "hello abc","ABC","aBc goodbye" }
</programlisting> </programlisting>
<para> <para>
<code>[hello]</code> designates an <code>iterator_range</code> delimiting this substring. <code>[hello]</code> designates an <code>iterator_range</code> delimiting this substring.

View File

@@ -114,10 +114,13 @@ public:
result_type operator()( const ReplaceT& Replace ) const result_type operator()( const ReplaceT& Replace ) const
{ {
SeqT r; SeqT r;
r.push_back( repeat_mark<value_type>() ); if(!Replace.empty())
r.push_back( *(Replace.begin()) ); {
r.push_back( value_type( Replace.size() ) ); r.push_back( repeat_mark<value_type>() );
r.push_back( *(Replace.begin()) );
r.push_back( value_type( Replace.size() ) );
}
return r; return r;
} }
}; };
@@ -183,14 +186,18 @@ public:
template< typename ReplaceT > template< typename ReplaceT >
result_type operator()( const ReplaceT& Replace ) const result_type operator()( const ReplaceT& Replace ) const
{ {
// extract info
typename ReplaceT::const_iterator It=Replace.begin();
value_type Value=*(++It);
value_type Repeat=*(++It);
SeqT r; SeqT r;
for( value_type Index=0; Index<Repeat; Index++ ) r.push_back( Value );
if(!Replace.empty())
{
// extract info
typename ReplaceT::const_iterator It=Replace.begin();
value_type Value=*(++It);
value_type Repeat=*(++It);
for( value_type Index=0; Index<Repeat; Index++ ) r.push_back( Value );
}
return r; return r;
} }

View File

@@ -59,5 +59,11 @@ test-suite algorithm/string
: :
: regex : regex
] ]
[ run
find_format_test.cpp
: :
:
: find_format
]
; ;

View File

@@ -0,0 +1,163 @@
// Boost string_algo library find_format_test.cpp file ------------------//
// Copyright (c) 2009 Steven Watanabe
// Distributed under the Boost Software License, Version 1.0. (See
// accompanying file LICENSE_1_0.txt or copy at
// http://www.boost.org/LICENSE_1_0.txt)
// See http://www.boost.org for updates, documentation, and revision history.
#include <boost/algorithm/string/find_format.hpp>
#include <boost/algorithm/string/finder.hpp>
#include <boost/algorithm/string/formatter.hpp>
// Include unit test framework
#include <boost/test/included/test_exec_monitor.hpp>
#include <boost/test/test_tools.hpp>
// We're only using const_formatter.
template<class Formatter>
struct formatter_result {
typedef boost::iterator_range<const char*> type;
};
template<class Formatter>
struct checked_formatter {
public:
checked_formatter(const Formatter& formatter) : formatter_(formatter) {}
template< typename T >
typename formatter_result<Formatter>::type operator()( const T & s ) const {
BOOST_CHECK( !s.empty() );
return formatter_(s);
}
private:
Formatter formatter_;
};
template<class Formatter>
checked_formatter<Formatter>
make_checked_formatter(const Formatter& formatter) {
return checked_formatter<Formatter>(formatter);
}
void find_format_test()
{
const std::string source = "$replace $replace";
std::string expected = "ok $replace";
std::string output(80, '\0');
std::string::iterator pos =
boost::find_format_copy(
output.begin(),
source,
boost::first_finder("$replace"),
make_checked_formatter(boost::const_formatter("ok")));
BOOST_CHECK(pos == output.begin() + expected.size());
output.erase(std::remove(output.begin(), output.end(), '\0'), output.end());
BOOST_CHECK_EQUAL(output, expected);
output =
boost::find_format_copy(
source,
boost::first_finder("$replace"),
make_checked_formatter(boost::const_formatter("ok")));
BOOST_CHECK_EQUAL(output, expected);
// now try finding a string that doesn't exist
output.resize(80);
pos =
boost::find_format_copy(
output.begin(),
source,
boost::first_finder("$noreplace"),
make_checked_formatter(boost::const_formatter("bad")));
BOOST_CHECK(pos == output.begin() + source.size());
output.erase(std::remove(output.begin(), output.end(), '\0'), output.end());
BOOST_CHECK_EQUAL(output, source);
output =
boost::find_format_copy(
source,
boost::first_finder("$noreplace"),
make_checked_formatter(boost::const_formatter("bad")));
BOOST_CHECK_EQUAL(output, source);
// in place version
output = source;
boost::find_format(
output,
boost::first_finder("$replace"),
make_checked_formatter(boost::const_formatter("ok")));
BOOST_CHECK_EQUAL(output, expected);
output = source;
boost::find_format(
output,
boost::first_finder("$noreplace"),
make_checked_formatter(boost::const_formatter("bad")));
BOOST_CHECK_EQUAL(output, source);
}
void find_format_all_test()
{
const std::string source = "$replace $replace";
std::string expected = "ok ok";
std::string output(80, '\0');
std::string::iterator pos =
boost::find_format_all_copy(output.begin(),
source,
boost::first_finder("$replace"),
boost::const_formatter("ok"));
BOOST_CHECK(pos == output.begin() + expected.size());
output.erase(std::remove(output.begin(), output.end(), '\0'), output.end());
BOOST_CHECK_EQUAL(output, expected);
output =
boost::find_format_all_copy(
source,
boost::first_finder("$replace"),
make_checked_formatter(boost::const_formatter("ok")));
BOOST_CHECK_EQUAL(output, expected);
// now try finding a string that doesn't exist
output.resize(80);
pos =
boost::find_format_all_copy(
output.begin(),
source,
boost::first_finder("$noreplace"),
make_checked_formatter(boost::const_formatter("bad")));
BOOST_CHECK(pos == output.begin() + source.size());
output.erase(std::remove(output.begin(), output.end(), '\0'), output.end());
BOOST_CHECK_EQUAL(output, source);
output =
boost::find_format_all_copy(
source,
boost::first_finder("$noreplace"),
make_checked_formatter(boost::const_formatter("bad")));
BOOST_CHECK_EQUAL(output, source);
// in place version
output = source;
boost::find_format_all(
output,
boost::first_finder("$replace"),
make_checked_formatter(boost::const_formatter("ok")));
BOOST_CHECK_EQUAL(output, expected);
output = source;
boost::find_format_all(
output,
boost::first_finder("$noreplace"),
make_checked_formatter(boost::const_formatter("bad")));
BOOST_CHECK_EQUAL(output, source);
}
int test_main( int, char*[] )
{
find_format_test();
find_format_all_test();
return 0;
}

View File

@@ -96,10 +96,29 @@ void predicate_test()
} }
template<typename Pred, typename Input>
void test_pred(const Pred& pred, const Input& input, bool bYes)
{
// test assignment operator
Pred pred1=pred;
pred1=pred;
pred1=pred1;
if(bYes)
{
BOOST_CHECK( all( input, pred ) );
BOOST_CHECK( all( input, pred1 ) );
}
else
{
BOOST_CHECK( !all( input, pred ) );
BOOST_CHECK( !all( input, pred1 ) );
}
}
#define TEST_CLASS( Pred, YesInput, NoInput )\ #define TEST_CLASS( Pred, YesInput, NoInput )\
{\ {\
BOOST_CHECK( all( string(YesInput), Pred ) );\ test_pred(Pred, YesInput, true); \
BOOST_CHECK( !all( string(NoInput), Pred ) );\ test_pred(Pred, NoInput, false); \
} }
void classification_test() void classification_test()
@@ -121,6 +140,14 @@ void classification_test()
TEST_CLASS( !is_classified(std::ctype_base::space), "...", "..\n\r\t " ); TEST_CLASS( !is_classified(std::ctype_base::space), "...", "..\n\r\t " );
TEST_CLASS( ( !is_any_of("abc") && is_from_range('a','e') ) || is_space(), "d e", "abcde" ); TEST_CLASS( ( !is_any_of("abc") && is_from_range('a','e') ) || is_space(), "d e", "abcde" );
// is_any_of test
// TEST_CLASS( !is_any_of(""), "", "aaa" )
TEST_CLASS( is_any_of("a"), "a", "ab" )
TEST_CLASS( is_any_of("ba"), "ab", "abc" )
TEST_CLASS( is_any_of("cba"), "abc", "abcd" )
TEST_CLASS( is_any_of("hgfedcba"), "abcdefgh", "abcdefghi" )
TEST_CLASS( is_any_of("qponmlkjihgfedcba"), "abcdefghijklmnopq", "zzz" )
} }
#undef TEST_CLASS #undef TEST_CLASS

View File

@@ -11,6 +11,9 @@
#include <boost/algorithm/string/erase.hpp> #include <boost/algorithm/string/erase.hpp>
#include <boost/algorithm/string/std/list_traits.hpp> #include <boost/algorithm/string/std/list_traits.hpp>
#include <boost/algorithm/string/std/string_traits.hpp> #include <boost/algorithm/string/std/string_traits.hpp>
#include <boost/algorithm/string/finder.hpp>
#include <boost/algorithm/string/formatter.hpp>
#include <boost/algorithm/string/classification.hpp>
// Include unit test framework // Include unit test framework
#include <boost/test/included/test_exec_monitor.hpp> #include <boost/test/included/test_exec_monitor.hpp>
@@ -120,6 +123,7 @@ void replace_all_test()
{ {
// replace all // replace all
TEST_ALGO( replace_all, "1abc3abc2", string("abc") C_ string("YYY"), string("1YYY3YYY2") ); TEST_ALGO( replace_all, "1abc3abc2", string("abc") C_ string("YYY"), string("1YYY3YYY2") );
TEST_ALGO( replace_all, string("1abc3abc2"), "/" C_ "\\", string("1abc3abc2") );
TEST_ALGO( ireplace_all, "1aBc3AbC2", "abC" C_ "YYY", string("1YYY3YYY2") ); TEST_ALGO( ireplace_all, "1aBc3AbC2", "abC" C_ "YYY", string("1YYY3YYY2") );
TEST_ALGO( replace_all, "1abc3abc2", string("abc") C_ string("Z"), string("1Z3Z2") ); TEST_ALGO( replace_all, "1abc3abc2", string("abc") C_ string("Z"), string("1Z3Z2") );
TEST_ALGO( replace_all, "1abc3abc2", string("abc") C_ string("XXXX"), string("1XXXX3XXXX2") ); TEST_ALGO( replace_all, "1abc3abc2", string("abc") C_ string("XXXX"), string("1XXXX3XXXX2") );
@@ -284,6 +288,23 @@ void collection_comp_test()
} }
} }
void dissect_format_test()
{
BOOST_CHECK(
find_format_all_copy(
string("aBc123Abc"),
first_finder("abc", is_iequal()),
dissect_formatter(token_finder(is_upper())))=="B123A");
BOOST_CHECK(
find_format_all_copy(
string("abc 123 abc"),
token_finder(is_space(), token_compress_on),
dissect_formatter(head_finder(1)))=="abc 123 abc");
}
// test main // test main
int test_main( int, char*[] ) int test_main( int, char*[] )
{ {
@@ -296,6 +317,7 @@ int test_main( int, char*[] )
replace_tail_test(); replace_tail_test();
replace_range_test(); replace_range_test();
collection_comp_test(); collection_comp_test();
dissect_format_test();
return 0; return 0;
} }

View File

@@ -40,6 +40,7 @@ void iterator_test()
string str1("xx-abc--xx-abb"); string str1("xx-abc--xx-abb");
string str2("Xx-abc--xX-abb-xx"); string str2("Xx-abc--xX-abb-xx");
string str3("xx"); string str3("xx");
string strempty("");
const char* pch1="xx-abc--xx-abb"; const char* pch1="xx-abc--xx-abb";
vector<string> tokens; vector<string> tokens;
vector< vector<int> > vtokens; vector< vector<int> > vtokens;
@@ -123,6 +124,25 @@ void iterator_test()
BOOST_CHECK( tokens[3]==string("xx") ); BOOST_CHECK( tokens[3]==string("xx") );
BOOST_CHECK( tokens[4]==string("abb") ); BOOST_CHECK( tokens[4]==string("abb") );
split(
tokens,
str3,
is_any_of(","),
token_compress_off);
BOOST_REQUIRE( tokens.size()==1 );
BOOST_CHECK( tokens[0]==string("xx") );
split(
tokens,
strempty,
is_punct(),
token_compress_off);
BOOST_REQUIRE( tokens.size()==1 );
BOOST_CHECK( tokens[0]==string("") );
find_iterator<string::iterator> fiter=make_find_iterator(str1, first_finder("xx")); find_iterator<string::iterator> fiter=make_find_iterator(str1, first_finder("xx"));
BOOST_CHECK(equals(*fiter, "xx")); BOOST_CHECK(equals(*fiter, "xx"));
++fiter; ++fiter;
@@ -139,6 +159,7 @@ void iterator_test()
++siter; ++siter;
BOOST_CHECK(equals(*siter, "abb")); BOOST_CHECK(equals(*siter, "abb"));
++siter; ++siter;
BOOST_CHECK(siter==split_iterator<string::iterator>(siter));
BOOST_CHECK(siter==split_iterator<string::iterator>()); BOOST_CHECK(siter==split_iterator<string::iterator>());
} }

View File

@@ -8,6 +8,7 @@
// See http://www.boost.org for updates, documentation, and revision history. // See http://www.boost.org for updates, documentation, and revision history.
#include <boost/algorithm/string/trim.hpp> #include <boost/algorithm/string/trim.hpp>
#include <boost/algorithm/string/trim_all.hpp>
// Include unit test framework // Include unit test framework
#include <boost/test/included/test_exec_monitor.hpp> #include <boost/test/included/test_exec_monitor.hpp>
@@ -109,10 +110,95 @@ void trim_test()
BOOST_CHECK( trim_copy_if( string("<>abc<>"), is_any_of( "<<>>" ) )=="abc" ); BOOST_CHECK( trim_copy_if( string("<>abc<>"), is_any_of( "<<>>" ) )=="abc" );
} }
void trim_all_test()
{
string str1(" 1x x x x1 ");
string str2("+---...2x+--x--+x-+-x2...---+");
string str3(" ");
// *** value passing tests *** //
// general string test
BOOST_CHECK( trim_all_copy( str1 )=="1x x x x1" ) ;
BOOST_CHECK( trim_all_copy_if( str2, is_punct() )=="2x+x-x-x2" ) ;
// spaces-only string test
BOOST_CHECK( trim_all_copy( str3 )=="" );
// empty string check
BOOST_CHECK( trim_all_copy( string("") )=="" );
// general string test
trim_all( str1 );
BOOST_CHECK( str1=="1x x x x1" ) ;
trim_all_if( str2, is_punct() );
BOOST_CHECK( str2=="2x+x-x-x2" ) ;
// spaces-only string test
str3 = " "; trim_all( str3 );
BOOST_CHECK( str3=="" );
// empty string check
str3 = ""; trim_all( str3 );
BOOST_CHECK( str3=="" );
BOOST_CHECK( str3=="" );
// *** non-standard predicate tests *** //
BOOST_CHECK(
trim_all_copy_if(
string("123abc127deb456"),
is_classified(std::ctype_base::digit) )=="abc1deb" );
BOOST_CHECK( trim_all_copy_if( string("<>abc<>def<>"), is_any_of( "<<>>" ) )=="abc<def" );
}
void trim_fill_test()
{
string str1(" 1x x x x1 ");
string str2("+---...2x+--x--+x-+-x2...---+");
string str3(" ");
// *** value passing tests *** //
// general string test
BOOST_CHECK( trim_fill_copy( str1, "-" )=="1x-x-x-x1" ) ;
BOOST_CHECK( trim_fill_copy_if( str2, " ", is_punct() )=="2x x x x2" ) ;
// spaces-only string test
BOOST_CHECK( trim_fill_copy( str3, " " )=="" );
// empty string check
BOOST_CHECK( trim_fill_copy( string(""), " " )=="" );
// general string test
trim_fill( str1, "-" );
BOOST_CHECK( str1=="1x-x-x-x1" ) ;
trim_fill_if( str2, "", is_punct() );
BOOST_CHECK( str2=="2xxxx2" ) ;
// spaces-only string test
str3 = " "; trim_fill( str3, "" );
BOOST_CHECK( str3=="" );
// empty string check
str3 = ""; trim_fill( str3, "" );
BOOST_CHECK( str3=="" );
BOOST_CHECK( str3=="" );
// *** non-standard predicate tests *** //
BOOST_CHECK(
trim_fill_copy_if(
string("123abc127deb456"),
"+",
is_classified(std::ctype_base::digit) )=="abc+deb" );
BOOST_CHECK( trim_fill_copy_if( string("<>abc<>def<>"), "-", is_any_of( "<<>>" ) )=="abc-def" );
}
// test main // test main
int test_main( int, char*[] ) int test_main( int, char*[] )
{ {
trim_test(); trim_test();
trim_all_test();
trim_fill_test();
return 0; return 0;
} }

44
test/Jamfile.v2 Executable file
View File

@@ -0,0 +1,44 @@
# Boost algorithm library test suite Jamfile ----------------------------
#
# Copyright Marshall Clow 2010-2012. Use, modification and
# distribution is subject to the Boost Software License, Version
# 1.0. (See accompanying file LICENSE_1_0.txt or copy at
# http://www.boost.org/LICENSE_1_0.txt)
#
# See http://www.boost.org for updates, documentation, and revision history.
import testing ;
{
test-suite algorithm:
# Search tests
: [ run empty_search_test.cpp : : : : empty_search_test ]
[ run search_test1.cpp : : : : search_test1 ]
[ run search_test2.cpp : : : : search_test2 ]
[ run search_test3.cpp : : : : search_test3 ]
[ compile-fail search_fail1.cpp : : : : ]
[ compile-fail search_fail2.cpp : : : : ]
[ compile-fail search_fail3.cpp : : : : ]
# Clamp tests
[ run clamp_test.cpp : : : : clamp_test ]
# Cxx11 tests
[ run all_of_test.cpp : : : : all_of_test ]
[ run any_of_test.cpp : : : : any_of_test ]
[ run none_of_test.cpp : : : : none_of_test ]
[ run one_of_test.cpp : : : : one_of_test ]
[ run ordered_test.cpp : : : : ordered_test ]
[ run find_if_not_test1.cpp : : : : find_if_not_test1 ]
[ run copy_n_test1.cpp : : : : copy_n_test1 ]
[ run iota_test1.cpp : : : : iota_test1 ]
[ run is_permutation_test1.cpp : : : : is_permutation_test1 ]
[ run partition_point_test1.cpp : : : : partition_point_test1 ]
[ run is_partitioned_test1.cpp : : : : is_partitioned_test1 ]
[ run partition_copy_test1.cpp : : : : partition_copy_test1 ]
;
}

86
test/all_of_test.cpp Normal file
View File

@@ -0,0 +1,86 @@
/*
Copyright (c) Marshall Clow 2010-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
For more information, see http://www.boost.org
*/
#include <boost/config.hpp>
#include <boost/algorithm/cxx11/all_of.hpp>
#include <boost/test/included/test_exec_monitor.hpp>
#include <functional>
#include <vector>
#include <list>
template<typename T>
struct is_ : public std::unary_function<T, bool> {
is_ ( T v ) : val_ ( v ) {}
~is_ () {}
bool operator () ( T comp ) const { return val_ == comp; }
private:
is_ (); // need a value
T val_;
};
namespace ba = boost::algorithm;
void test_all ()
{
// Note: The literal values here are tested against directly, careful if you change them:
int some_numbers[] = { 1, 1, 1, 18, 10 };
std::vector<int> vi(some_numbers, some_numbers + 5);
std::list<int> li(vi.begin(), vi.end ());
int some_letters[] = { 'a', 'q', 'n', 'y', 'n' };
std::vector<char> vc(some_letters, some_letters + 5);
BOOST_CHECK (!ba::all_of_equal ( vi, 1 ));
BOOST_CHECK (!ba::all_of ( vi, is_<int> ( 1 )));
BOOST_CHECK (!ba::all_of_equal ( vi.begin(), vi.end(), 1 ));
BOOST_CHECK (!ba::all_of ( vi.begin(), vi.end(), is_<int> ( 1 )));
BOOST_CHECK (!ba::all_of_equal ( vi, 0 ));
BOOST_CHECK (!ba::all_of ( vi, is_<int> ( 0 )));
BOOST_CHECK (!ba::all_of_equal ( vi.begin(), vi.end(), 0 ));
BOOST_CHECK (!ba::all_of ( vi.begin(), vi.end(), is_<int> ( 0 )));
BOOST_CHECK ( ba::all_of_equal ( vi.end(), vi.end(), 0 ));
BOOST_CHECK ( ba::all_of ( vi.end(), vi.end(), is_<int> ( 0 )));
BOOST_CHECK ( ba::all_of_equal ( vi.begin(), vi.begin () + 3, 1 ));
BOOST_CHECK ( ba::all_of ( vi.begin(), vi.begin () + 3, is_<int> ( 1 )));
BOOST_CHECK ( ba::all_of_equal ( vc.begin() + 1, vc.begin() + 2, 'q' ));
BOOST_CHECK ( ba::all_of ( vc.begin() + 1, vc.begin() + 2, is_<char> ( 'q' )));
BOOST_CHECK (!ba::all_of_equal ( vc, '!' ));
BOOST_CHECK (!ba::all_of ( vc, is_<char> ( '!' )));
BOOST_CHECK ( ba::all_of_equal ( vi.begin(), vi.begin(), 1 ));
BOOST_CHECK ( ba::all_of_equal ( vc.begin(), vc.begin(), 'a' ));
BOOST_CHECK ( ba::all_of ( vi.begin(), vi.begin(), is_<int> ( 1 )));
BOOST_CHECK ( ba::all_of ( vc.begin(), vc.begin(), is_<char> ( 'a' )));
BOOST_CHECK (!ba::all_of_equal ( li, 1 ));
BOOST_CHECK (!ba::all_of ( li, is_<int> ( 1 )));
BOOST_CHECK (!ba::all_of_equal ( li.begin(), li.end(), 1 ));
BOOST_CHECK (!ba::all_of ( li.begin(), li.end(), is_<int> ( 1 )));
std::list<int>::iterator l_iter = li.begin ();
l_iter++; l_iter++; l_iter++;
BOOST_CHECK ( ba::all_of_equal ( li.begin(), l_iter, 1 ));
BOOST_CHECK ( ba::all_of ( li.begin(), l_iter, is_<int> ( 1 )));
}
int test_main( int , char* [] )
{
test_all ();
return 0;
}

105
test/any_of_test.cpp Normal file
View File

@@ -0,0 +1,105 @@
/*
Copyright (c) Marshall Clow 2010-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
For more information, see http://www.boost.org
*/
#include <boost/config.hpp>
#include <boost/algorithm/cxx11/any_of.hpp>
#include <boost/test/included/test_exec_monitor.hpp>
#include <functional>
#include <vector>
#include <list>
template<typename T>
struct is_ : public std::unary_function<T, bool> {
is_ ( T v ) : val_ ( v ) {}
~is_ () {}
bool operator () ( T comp ) const { return val_ == comp; }
private:
is_ (); // need a value
T val_;
};
namespace ba = boost::algorithm;
void test_any ()
{
// Note: The literal values here are tested against directly, careful if you change them:
int some_numbers[] = { 1, 5, 0, 18, 10 };
std::vector<int> vi(some_numbers, some_numbers + 5);
std::list<int> li(vi.begin(), vi.end ());
int some_letters[] = { 'a', 'q', 'n', 'y', 'n' };
std::vector<char> vc(some_letters, some_letters + 5);
BOOST_CHECK ( ba::any_of_equal ( vi, 1 ));
BOOST_CHECK ( ba::any_of ( vi, is_<int> ( 1 )));
BOOST_CHECK ( ba::any_of_equal ( vi.begin(), vi.end(), 1 ));
BOOST_CHECK ( ba::any_of ( vi.begin(), vi.end(), is_<int> ( 1 )));
BOOST_CHECK (!ba::any_of_equal ( vi, 9 ));
BOOST_CHECK (!ba::any_of ( vi, is_<int> ( 9 )));
BOOST_CHECK (!ba::any_of_equal ( vi.begin(), vi.end(), 9 ));
BOOST_CHECK (!ba::any_of ( vi.begin(), vi.end(), is_<int> ( 9 )));
BOOST_CHECK ( ba::any_of_equal ( vi, 10 ));
BOOST_CHECK ( ba::any_of ( vi, is_<int> ( 10 )));
BOOST_CHECK (!ba::any_of_equal ( vi, 4 ));
BOOST_CHECK (!ba::any_of ( vi, is_<int> ( 4 )));
BOOST_CHECK (!ba::any_of_equal ( vi.end(), vi.end(), 0 ));
BOOST_CHECK (!ba::any_of ( vi.end(), vi.end(), is_<int> ( 0 )));
// 5 is not in { 0, 18, 10 }, but 10 is
BOOST_CHECK ( ba::any_of_equal ( vi.begin() + 2, vi.end(), 10 ));
BOOST_CHECK ( ba::any_of ( vi.begin() + 2, vi.end(), is_<int> ( 10 )));
BOOST_CHECK (!ba::any_of_equal ( vi.begin() + 2, vi.end(), 5 ));
BOOST_CHECK (!ba::any_of ( vi.begin() + 2, vi.end(), is_<int> ( 5 )));
// 18 is not in { 1, 5, 0 }, but 5 is
BOOST_CHECK ( ba::any_of_equal ( vi.begin(), vi.begin() + 3, 5 ));
BOOST_CHECK ( ba::any_of ( vi.begin(), vi.begin() + 3, is_<int> ( 5 )));
BOOST_CHECK (!ba::any_of_equal ( vi.begin(), vi.begin() + 3, 18 ));
BOOST_CHECK (!ba::any_of ( vi.begin(), vi.begin() + 3, is_<int> ( 18 )));
BOOST_CHECK ( ba::any_of_equal ( vc, 'q' ));
BOOST_CHECK ( ba::any_of ( vc, is_<char> ( 'q' )));
BOOST_CHECK (!ba::any_of_equal ( vc, '!' ));
BOOST_CHECK (!ba::any_of ( vc, is_<char> ( '!' )));
BOOST_CHECK ( ba::any_of_equal ( vc, 'n' ));
BOOST_CHECK ( ba::any_of ( vc, is_<char> ( 'n' )));
BOOST_CHECK (!ba::any_of_equal ( vi.begin(), vi.begin(), 1 ));
BOOST_CHECK (!ba::any_of_equal ( vc.begin(), vc.begin(), 'a' ));
BOOST_CHECK (!ba::any_of ( vi.begin(), vi.begin(), is_<int> ( 1 )));
BOOST_CHECK (!ba::any_of ( vc.begin(), vc.begin(), is_<char> ( 'a' )));
BOOST_CHECK ( ba::any_of_equal ( li, 1 ));
BOOST_CHECK ( ba::any_of ( li, is_<int> ( 1 )));
BOOST_CHECK ( ba::any_of_equal ( li.begin(), li.end(), 1 ));
BOOST_CHECK ( ba::any_of ( li.begin(), li.end(), is_<int> ( 1 )));
std::list<int>::iterator l_iter = li.begin ();
l_iter++; l_iter++; l_iter++;
BOOST_CHECK ( ba::any_of_equal ( li.begin(), l_iter, 5 ));
BOOST_CHECK ( ba::any_of ( li.begin(), l_iter, is_<int> ( 5 )));
BOOST_CHECK (!ba::any_of_equal ( li.begin(), l_iter, 18 ));
BOOST_CHECK (!ba::any_of ( li.begin(), l_iter, is_<int> ( 18 )));
}
int test_main( int , char* [] )
{
test_any ();
return 0;
}

218
test/clamp_test.cpp Executable file
View File

@@ -0,0 +1,218 @@
// (C) Copyright Jesse Williamson 2009
// Use, modification and distribution are subject to the
// Boost Software License, Version 1.0. (See accompanying file
// LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
#include <iostream>
#include <vector>
#include <boost/config.hpp>
#include <boost/algorithm/clamp.hpp>
#include <boost/test/included/test_exec_monitor.hpp>
namespace ba = boost::algorithm;
bool intGreater ( int lhs, int rhs ) { return lhs > rhs; }
bool doubleGreater ( double lhs, double rhs ) { return lhs > rhs; }
class custom {
public:
custom ( int x ) : v(x) {}
custom ( const custom &rhs ) : v(rhs.v) {}
~custom () {}
custom & operator = ( const custom &rhs ) { v = rhs.v; return *this; }
bool operator < ( const custom &rhs ) const { return v < rhs.v; }
bool operator == ( const custom &rhs ) const { return v == rhs.v; } // need this for the test
std::ostream & print ( std::ostream &os ) const { return os << v; }
int v;
};
std::ostream & operator << ( std::ostream & os, const custom &x ) { return x.print ( os ); }
bool customLess ( const custom &lhs, const custom &rhs ) { return lhs.v < rhs.v; }
void test_ints()
{
// Inside the range, equal to the endpoints, and outside the endpoints.
BOOST_CHECK_EQUAL ( 3, ba::clamp ( 3, 1, 10 ));
BOOST_CHECK_EQUAL ( 1, ba::clamp ( 1, 1, 10 ));
BOOST_CHECK_EQUAL ( 1, ba::clamp ( 0, 1, 10 ));
BOOST_CHECK_EQUAL ( 10, ba::clamp ( 10, 1, 10 ));
BOOST_CHECK_EQUAL ( 10, ba::clamp ( 11, 1, 10 ));
BOOST_CHECK_EQUAL ( 3, ba::clamp ( 3, 10, 1, intGreater ));
BOOST_CHECK_EQUAL ( 1, ba::clamp ( 1, 10, 1, intGreater ));
BOOST_CHECK_EQUAL ( 1, ba::clamp ( 0, 10, 1, intGreater ));
BOOST_CHECK_EQUAL ( 10, ba::clamp ( 10, 10, 1, intGreater ));
BOOST_CHECK_EQUAL ( 10, ba::clamp ( 11, 10, 1, intGreater ));
// Negative numbers
BOOST_CHECK_EQUAL ( -3, ba::clamp ( -3, -10, -1 ));
BOOST_CHECK_EQUAL ( -1, ba::clamp ( -1, -10, -1 ));
BOOST_CHECK_EQUAL ( -1, ba::clamp ( 0, -10, -1 ));
BOOST_CHECK_EQUAL ( -10, ba::clamp ( -10, -10, -1 ));
BOOST_CHECK_EQUAL ( -10, ba::clamp ( -11, -10, -1 ));
// Mixed positive and negative numbers
BOOST_CHECK_EQUAL ( 5, ba::clamp ( 5, -10, 10 ));
BOOST_CHECK_EQUAL ( -10, ba::clamp ( -10, -10, 10 ));
BOOST_CHECK_EQUAL ( -10, ba::clamp ( -15, -10, 10 ));
BOOST_CHECK_EQUAL ( 10, ba::clamp ( 10, -10, 10 ));
BOOST_CHECK_EQUAL ( 10, ba::clamp ( 15, -10, 10 ));
// Unsigned
BOOST_CHECK_EQUAL ( 5U, ba::clamp ( 5U, 1U, 10U ));
BOOST_CHECK_EQUAL ( 1U, ba::clamp ( 1U, 1U, 10U ));
BOOST_CHECK_EQUAL ( 1U, ba::clamp ( 0U, 1U, 10U ));
BOOST_CHECK_EQUAL ( 10U, ba::clamp ( 10U, 1U, 10U ));
BOOST_CHECK_EQUAL ( 10U, ba::clamp ( 15U, 1U, 10U ));
// Mixed (1)
BOOST_CHECK_EQUAL ( 5U, ba::clamp ( 5U, 1, 10 ));
BOOST_CHECK_EQUAL ( 1U, ba::clamp ( 1U, 1, 10 ));
BOOST_CHECK_EQUAL ( 1U, ba::clamp ( 0U, 1, 10 ));
BOOST_CHECK_EQUAL ( 10U, ba::clamp ( 10U, 1, 10 ));
BOOST_CHECK_EQUAL ( 10U, ba::clamp ( 15U, 1, 10 ));
// Mixed (3)
BOOST_CHECK_EQUAL ( 5U, ba::clamp ( 5U, 1, 10. ));
BOOST_CHECK_EQUAL ( 1U, ba::clamp ( 1U, 1, 10. ));
BOOST_CHECK_EQUAL ( 1U, ba::clamp ( 0U, 1, 10. ));
BOOST_CHECK_EQUAL ( 10U, ba::clamp ( 10U, 1, 10. ));
BOOST_CHECK_EQUAL ( 10U, ba::clamp ( 15U, 1, 10. ));
short foo = 50;
BOOST_CHECK_EQUAL ( 56, ba::clamp ( foo, 56.9, 129 ));
BOOST_CHECK_EQUAL ( 24910, ba::clamp ( foo, 12345678, 123456999 ));
}
void test_floats()
{
// Inside the range, equal to the endpoints, and outside the endpoints.
BOOST_CHECK_EQUAL ( 3.0, ba::clamp ( 3.0, 1.0, 10.0 ));
BOOST_CHECK_EQUAL ( 1.0, ba::clamp ( 1.0, 1.0, 10.0 ));
BOOST_CHECK_EQUAL ( 1.0, ba::clamp ( 0.0, 1.0, 10.0 ));
BOOST_CHECK_EQUAL ( 10.0, ba::clamp ( 10.0, 1.0, 10.0 ));
BOOST_CHECK_EQUAL ( 10.0, ba::clamp ( 11.0, 1.0, 10.0 ));
BOOST_CHECK_EQUAL ( 3.0, ba::clamp ( 3.0, 10.0, 1.0, doubleGreater ));
BOOST_CHECK_EQUAL ( 1.0, ba::clamp ( 1.0, 10.0, 1.0, doubleGreater ));
BOOST_CHECK_EQUAL ( 1.0, ba::clamp ( 0.0, 10.0, 1.0, doubleGreater ));
BOOST_CHECK_EQUAL ( 10.0, ba::clamp ( 10.0, 10.0, 1.0, doubleGreater ));
BOOST_CHECK_EQUAL ( 10.0, ba::clamp ( 11.0, 10.0, 1.0, doubleGreater ));
// Negative numbers
BOOST_CHECK_EQUAL ( -3.f, ba::clamp ( -3.f, -10.f, -1.f ));
BOOST_CHECK_EQUAL ( -1.f, ba::clamp ( -1.f, -10.f, -1.f ));
BOOST_CHECK_EQUAL ( -1.f, ba::clamp ( 0.f, -10.f, -1.f ));
BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -10.f, -10.f, -1.f ));
BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -11.f, -10.f, -1.f ));
// Mixed positive and negative numbers
BOOST_CHECK_EQUAL ( 5.f, ba::clamp ( 5.f, -10.f, 10.f ));
BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -10.f, -10.f, 10.f ));
BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -15.f, -10.f, 10.f ));
BOOST_CHECK_EQUAL ( 10.f, ba::clamp ( 10.f, -10.f, 10.f ));
BOOST_CHECK_EQUAL ( 10.f, ba::clamp ( 15.f, -10.f, 10.f ));
// Mixed (1)
BOOST_CHECK_EQUAL ( 5.f, ba::clamp ( 5.f, -10., 10. ));
BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -10.f, -10., 10. ));
BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -15.f, -10., 10. ));
BOOST_CHECK_EQUAL ( 10.f, ba::clamp ( 10.f, -10., 10. ));
BOOST_CHECK_EQUAL ( 10.f, ba::clamp ( 15.f, -10., 10. ));
// Mixed (2)
BOOST_CHECK_EQUAL ( 5.f, ba::clamp ( 5.f, -10, 10 ));
BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -10.f, -10, 10 ));
BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -15.f, -10, 10 ));
BOOST_CHECK_EQUAL ( 10.f, ba::clamp ( 10.f, -10, 10 ));
BOOST_CHECK_EQUAL ( 10.f, ba::clamp ( 15.f, -10, 10 ));
}
void test_custom()
{
// Inside the range, equal to the endpoints, and outside the endpoints.
BOOST_CHECK_EQUAL ( custom( 3), ba::clamp ( custom( 3), custom(1), custom(10)));
BOOST_CHECK_EQUAL ( custom( 1), ba::clamp ( custom( 1), custom(1), custom(10)));
BOOST_CHECK_EQUAL ( custom( 1), ba::clamp ( custom( 0), custom(1), custom(10)));
BOOST_CHECK_EQUAL ( custom(10), ba::clamp ( custom(10), custom(1), custom(10)));
BOOST_CHECK_EQUAL ( custom(10), ba::clamp ( custom(11), custom(1), custom(10)));
BOOST_CHECK_EQUAL ( custom( 3), ba::clamp ( custom( 3), custom(1), custom(10), customLess ));
BOOST_CHECK_EQUAL ( custom( 1), ba::clamp ( custom( 1), custom(1), custom(10), customLess ));
BOOST_CHECK_EQUAL ( custom( 1), ba::clamp ( custom( 0), custom(1), custom(10), customLess ));
BOOST_CHECK_EQUAL ( custom(10), ba::clamp ( custom(10), custom(1), custom(10), customLess ));
BOOST_CHECK_EQUAL ( custom(10), ba::clamp ( custom(11), custom(1), custom(10), customLess ));
// Fail!!
// BOOST_CHECK_EQUAL ( custom(1), ba::clamp ( custom(11), custom(1), custom(10)));
}
#define elementsof(v) (sizeof (v) / sizeof (v[0]))
#define a_begin(v) (&v[0])
#define a_end(v) (v + elementsof (v))
#define a_range(v) v
#define b_e(v) a_begin(v),a_end(v)
void test_int_range ()
{
int inputs [] = { 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 19, 99, 999, -1, -3, -99, 234234 };
int outputs [] = { 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 10, 10, -1, -1, -1, 10 };
std::vector<int> results;
std::vector<int> in_v;
std::copy ( a_begin(inputs), a_end(inputs), std::back_inserter ( in_v ));
ba::clamp_range ( a_begin(inputs), a_end(inputs), std::back_inserter ( results ), -1, 10 );
BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
results.clear ();
ba::clamp_range ( in_v.begin (), in_v.end (), std::back_inserter ( results ), -1, 10 );
BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
results.clear ();
ba::clamp_range ( a_begin(inputs), a_end(inputs), std::back_inserter ( results ), 10, -1, intGreater );
BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
results.clear ();
ba::clamp_range ( in_v.begin (), in_v.end (), std::back_inserter ( results ), 10, -1, intGreater );
BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
results.clear ();
ba::clamp_range ( a_range(inputs), std::back_inserter ( results ), -1, 10 );
BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
results.clear ();
ba::clamp_range ( in_v, std::back_inserter ( results ), -1, 10 );
BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
results.clear ();
ba::clamp_range ( a_range(inputs), std::back_inserter ( results ), 10, -1, intGreater );
BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
results.clear ();
ba::clamp_range ( in_v, std::back_inserter ( results ), 10, -1, intGreater );
BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
results.clear ();
int junk[elementsof(inputs)];
ba::clamp_range ( inputs, junk, 10, -1, intGreater );
BOOST_CHECK ( std::equal ( b_e(junk), outputs ));
}
int test_main( int , char* [] )
{
test_ints ();
test_floats ();
test_custom ();
test_int_range ();
// test_float_range ();
// test_custom_range ();
return 0;
}

85
test/copy_n_test1.cpp Normal file
View File

@@ -0,0 +1,85 @@
/*
Copyright (c) Marshall Clow 2011-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
For more information, see http://www.boost.org
*/
#include <boost/config.hpp>
#include <boost/algorithm/cxx11/copy_n.hpp>
#include <boost/test/included/test_exec_monitor.hpp>
#include <string>
#include <iostream>
#include <vector>
#include <list>
namespace ba = boost::algorithm;
// namespace ba = boost;
template <typename Container>
void test_sequence ( Container const &c ) {
typedef typename Container::value_type value_type;
std::vector<value_type> v;
// Copy zero elements
v.clear ();
ba::copy_n ( c.begin (), 0, back_inserter ( v ));
BOOST_CHECK ( v.size () == 0 );
ba::copy_n ( c.begin (), 0U, back_inserter ( v ));
BOOST_CHECK ( v.size () == 0 );
if ( c.size () > 0 ) {
// Just one element
v.clear ();
ba::copy_n ( c.begin (), 1, back_inserter ( v ));
BOOST_CHECK ( v.size () == 1 );
BOOST_CHECK ( v[0] == *c.begin ());
v.clear ();
ba::copy_n ( c.begin (), 1U, back_inserter ( v ));
BOOST_CHECK ( v.size () == 1 );
BOOST_CHECK ( v[0] == *c.begin ());
// Half the elements
v.clear ();
ba::copy_n ( c.begin (), c.size () / 2, back_inserter ( v ));
BOOST_CHECK ( v.size () == c.size () / 2);
BOOST_CHECK ( std::equal ( v.begin (), v.end (), c.begin ()));
// Half the elements + 1
v.clear ();
ba::copy_n ( c.begin (), c.size () / 2 + 1, back_inserter ( v ));
BOOST_CHECK ( v.size () == c.size () / 2 + 1 );
BOOST_CHECK ( std::equal ( v.begin (), v.end (), c.begin ()));
// All the elements
v.clear ();
ba::copy_n ( c.begin (), c.size (), back_inserter ( v ));
BOOST_CHECK ( v.size () == c.size ());
BOOST_CHECK ( std::equal ( v.begin (), v.end (), c.begin ()));
}
}
void test_sequence1 () {
std::vector<int> v;
for ( int i = 5; i < 15; ++i )
v.push_back ( i );
test_sequence ( v );
std::list<int> l;
for ( int i = 25; i > 15; --i )
l.push_back ( i );
test_sequence ( l );
}
int test_main( int , char* [] )
{
test_sequence1 ();
return 0;
}

83
test/empty_search_test.cpp Executable file
View File

@@ -0,0 +1,83 @@
/*
Copyright (c) Marshall Clow 2010-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
For more information, see http://www.boost.org
*/
#include <string>
#include <boost/algorithm/searching/boyer_moore.hpp>
#include <boost/algorithm/searching/boyer_moore_horspool.hpp>
#include <boost/algorithm/searching/knuth_morris_pratt.hpp>
#include <boost/test/included/test_exec_monitor.hpp>
int test_main( int argc, char *argv [] )
{
const std::string cs;
std::string estr;
std::string str ( "abc" );
// empty corpus, empty pattern
BOOST_CHECK (
boost::algorithm::boyer_moore_search (
cs.begin (), cs.end (), estr.begin (), estr.end ())
== cs.begin ()
);
BOOST_CHECK (
boost::algorithm::boyer_moore_horspool_search (
cs.begin (), cs.end (), estr.begin (), estr.end ())
== cs.begin ()
);
BOOST_CHECK (
boost::algorithm::knuth_morris_pratt_search (
cs.begin (), cs.end (), estr.begin (), estr.end ())
== cs.begin ()
);
// empty corpus, non-empty pattern
BOOST_CHECK (
boost::algorithm::boyer_moore_search (
estr.begin (), estr.end (), str.begin (), str.end ())
== estr.end ()
);
BOOST_CHECK (
boost::algorithm::boyer_moore_horspool_search (
estr.begin (), estr.end (), str.begin (), str.end ())
== estr.end ()
);
BOOST_CHECK (
boost::algorithm::knuth_morris_pratt_search (
estr.begin (), estr.end (), str.begin (), str.end ())
== estr.end ()
);
// non-empty corpus, empty pattern
BOOST_CHECK (
boost::algorithm::boyer_moore_search (
str.begin (), str.end (), estr.begin (), estr.end ())
== str.begin ()
);
BOOST_CHECK (
boost::algorithm::boyer_moore_horspool_search (
str.begin (), str.end (), estr.begin (), estr.end ())
== str.begin ()
);
BOOST_CHECK (
boost::algorithm::knuth_morris_pratt_search (
str.begin (), str.end (), estr.begin (), estr.end ())
== str.begin ()
);
(void) argv; (void) argc;
return 0;
}

View File

@@ -0,0 +1,90 @@
/*
Copyright (c) Marshall Clow 2011-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
For more information, see http://www.boost.org
*/
#include <iostream>
#include <boost/config.hpp>
#include <boost/algorithm/cxx11/find_if_not.hpp>
#include <boost/test/included/test_exec_monitor.hpp>
#include <string>
#include <vector>
#include <list>
namespace ba = boost::algorithm;
// namespace ba = boost;
template <typename Container>
typename Container::iterator offset_to_iter ( Container &v, int offset ) {
typename Container::iterator retval;
if ( offset >= 0 ) {
retval = v.begin ();
std::advance ( retval, offset );
}
else {
retval = v.end ();
std::advance ( retval, offset + 1 );
}
return retval;
}
template <typename Container, typename Predicate>
void test_sequence ( Container &v, Predicate comp, int expected ) {
typename Container::iterator res, exp;
res = ba::find_if_not ( v.begin (), v.end (), comp );
exp = offset_to_iter ( v, expected );
std::cout << "Expected(1): " << std::distance ( v.begin (), exp )
<< ", got: " << std::distance ( v.begin (), res ) << std::endl;
BOOST_CHECK ( exp == res );
}
template <typename T>
struct less_than {
public:
less_than ( T foo ) : val ( foo ) {}
less_than ( const less_than &rhs ) : val ( rhs.val ) {}
bool operator () ( const T &v ) const { return v < val; }
private:
less_than ();
less_than operator = ( const less_than &rhs );
T val;
};
void test_sequence1 () {
std::vector<int> v;
v.clear ();
for ( int i = 5; i < 15; ++i )
v.push_back ( i );
test_sequence ( v, less_than<int>(3), 0 ); // no elements
test_sequence ( v, less_than<int>(6), 1 ); // only the first element
test_sequence ( v, less_than<int>(10), 5 );
test_sequence ( v, less_than<int>(99), -1 ); // all elements satisfy
// With bidirectional iterators.
std::list<int> l;
for ( int i = 5; i < 15; ++i )
l.push_back ( i );
test_sequence ( l, less_than<int>(3), 0 ); // no elements
test_sequence ( l, less_than<int>(6), 1 ); // only the first element
test_sequence ( l, less_than<int>(10), 5 );
test_sequence ( l, less_than<int>(99), -1 ); // all elements satisfy
}
int test_main( int , char* [] )
{
test_sequence1 ();
return 0;
}

79
test/iota_test1.cpp Normal file
View File

@@ -0,0 +1,79 @@
/*
Copyright (c) Marshall Clow 2011-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
For more information, see http://www.boost.org
*/
#include <boost/config.hpp>
#include <boost/algorithm/cxx11/iota.hpp>
#include <boost/test/included/test_exec_monitor.hpp>
#include <iostream>
#include <string>
#include <vector>
#include <list>
// Test to make sure a sequence is "correctly formed"; i.e, ascending by one
template <typename Iterator, typename T>
bool test_iota_results ( Iterator first, Iterator last, T initial_value ) {
if ( first == last ) return true;
if ( initial_value != *first ) return false;
Iterator prev = first;
while ( ++first != last ) {
if (( *first - *prev ) != 1 )
return false;
prev = first;
}
return true;
}
template <typename Range, typename T>
bool test_iota_results ( const Range &r, T initial_value ) {
return test_iota_results (boost::begin (r), boost::end (r), initial_value );
}
void test_ints () {
std::vector<int> v;
std::list<int> l;
v.clear (); v.reserve ( 10 );
boost::algorithm::iota ( v.begin (), v.end (), 23 );
BOOST_CHECK ( test_iota_results ( v.begin (), v.end (), 23 ));
v.clear (); v.reserve ( 19 );
boost::algorithm::iota ( v, 18 );
BOOST_CHECK ( test_iota_results ( v, 18 ));
v.clear ();
boost::algorithm::iota_n ( std::back_inserter(v), 99, 20 );
BOOST_CHECK ( test_iota_results ( v, 99 ));
/*
l.clear (); l.reserve ( 5 );
boost::algorithm::iota ( l.begin (), l.end (), 123 );
BOOST_CHECK ( test_iota_results ( l.begin (), l.end (), 123 ));
l.clear (); l.reserve ( 9 );
boost::algorithm::iota ( l.begin (), l.end (), 87 );
BOOST_CHECK ( test_iota_results ( l.begin (), l.end (), 87 ));
*/
l.clear ();
boost::algorithm::iota_n ( std::back_inserter(l), 99, 20 );
BOOST_CHECK ( test_iota_results ( l, 99 ));
l.clear ();
boost::algorithm::iota_n ( std::front_inserter(l), 123, 20 );
BOOST_CHECK ( test_iota_results ( l.rbegin (), l.rend (), 123 ));
}
int test_main( int , char* [] )
{
test_ints ();
return 0;
}

View File

@@ -0,0 +1,63 @@
/*
Copyright (c) Marshall Clow 2011-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
For more information, see http://www.boost.org
*/
#include <iostream>
#include <boost/config.hpp>
#include <boost/algorithm/cxx11/is_partitioned.hpp>
#include <boost/test/included/test_exec_monitor.hpp>
#include <string>
#include <vector>
#include <list>
namespace ba = boost::algorithm;
// namespace ba = boost;
template <typename T>
struct less_than {
public:
less_than ( T foo ) : val ( foo ) {}
less_than ( const less_than &rhs ) : val ( rhs.val ) {}
bool operator () ( const T &v ) const { return v < val; }
private:
less_than ();
less_than operator = ( const less_than &rhs );
T val;
};
void test_sequence1 () {
std::vector<int> v;
v.clear ();
for ( int i = 5; i < 15; ++i )
v.push_back ( i );
BOOST_CHECK ( ba::is_partitioned ( v, less_than<int>(3))); // no elements
BOOST_CHECK ( ba::is_partitioned ( v, less_than<int>(6))); // only the first element
BOOST_CHECK ( ba::is_partitioned ( v, less_than<int>(10))); // in the middle somewhere
BOOST_CHECK ( ba::is_partitioned ( v, less_than<int>(99))); // all elements satisfy
// With bidirectional iterators.
std::list<int> l;
for ( int i = 5; i < 15; ++i )
l.push_back ( i );
BOOST_CHECK ( ba::is_partitioned ( l.begin (), l.end (), less_than<int>(3))); // no elements
BOOST_CHECK ( ba::is_partitioned ( l.begin (), l.end (), less_than<int>(6))); // only the first element
BOOST_CHECK ( ba::is_partitioned ( l.begin (), l.end (), less_than<int>(10))); // in the middle somewhere
BOOST_CHECK ( ba::is_partitioned ( l.begin (), l.end (), less_than<int>(99))); // all elements satisfy
}
int test_main( int , char* [] )
{
test_sequence1 ();
return 0;
}

View File

@@ -0,0 +1,49 @@
/*
Copyright (c) Marshall Clow 2011-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
For more information, see http://www.boost.org
*/
#include <iostream>
#include <boost/config.hpp>
#include <boost/algorithm/cxx11/is_permutation.hpp>
#include <boost/test/included/test_exec_monitor.hpp>
#include <string>
#include <vector>
#include <list>
namespace ba = boost::algorithm;
// namespace ba = boost;
void test_sequence1 () {
std::vector<int> v, v1;
v.clear ();
for ( std::size_t i = 5; i < 15; ++i )
v.push_back ( i );
v1 = v;
BOOST_CHECK ( ba::is_permutation ( v.begin (), v.end (), v.begin ())); // better be a permutation of itself!
BOOST_CHECK ( ba::is_permutation ( v.begin (), v.end (), v1.begin ()));
// With bidirectional iterators.
std::list<int> l;
std::copy ( v.begin (), v.end (), std::back_inserter ( l ));
BOOST_CHECK ( ba::is_permutation ( l.begin (), l.end (), l.begin ())); // better be a permutation of itself!
BOOST_CHECK ( ba::is_permutation ( l.begin (), l.end (), v1.begin ()));
for ( std::size_t i = 0; i < l.size (); ++i ) {
l.push_back ( *l.begin ()); l.pop_front (); // rotation
BOOST_CHECK ( ba::is_permutation ( l.begin (), l.end (), v1.begin ()));
}
}
int test_main( int , char* [] )
{
test_sequence1 ();
return 0;
}

96
test/none_of_test.cpp Normal file
View File

@@ -0,0 +1,96 @@
/*
Copyright (c) Marshall Clow 2010-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
For more information, see http://www.boost.org
*/
#include <boost/config.hpp>
#include <boost/algorithm/cxx11/none_of.hpp>
#include <boost/test/included/test_exec_monitor.hpp>
#include <functional>
#include <vector>
#include <list>
template<typename T>
struct is_ : public std::unary_function<T, bool> {
is_ ( T v ) : val_ ( v ) {}
~is_ () {}
bool operator () ( T comp ) const { return val_ == comp; }
private:
is_ (); // need a value
T val_;
};
namespace ba = boost::algorithm;
void test_none()
{
// Note: The literal values here are tested against directly, careful if you change them:
int some_numbers[] = { 1, 5, 0, 18, 1 };
std::vector<int> vi(some_numbers, some_numbers + 5);
std::list<int> li(vi.begin(), vi.end ());
int some_letters[] = { 'a', 'q', 'n', 'y', 'n' };
std::vector<char> vc(some_letters, some_letters + 5);
BOOST_CHECK ( ba::none_of_equal ( vi, 100 ));
BOOST_CHECK ( ba::none_of ( vi, is_<int> ( 100 )));
BOOST_CHECK ( ba::none_of_equal ( vi.begin(), vi.end(), 100 ));
BOOST_CHECK ( ba::none_of ( vi.begin(), vi.end(), is_<int> ( 100 )));
BOOST_CHECK (!ba::none_of_equal ( vi, 1 ));
BOOST_CHECK (!ba::none_of ( vi, is_<int> ( 1 )));
BOOST_CHECK (!ba::none_of_equal ( vi.begin(), vi.end(), 1 ));
BOOST_CHECK (!ba::none_of ( vi.begin(), vi.end(), is_<int> ( 1 )));
BOOST_CHECK ( ba::none_of_equal ( vi.end(), vi.end(), 0 ));
BOOST_CHECK ( ba::none_of ( vi.end(), vi.end(), is_<int> ( 0 )));
// 5 is not in { 0, 18, 1 }, but 1 is
BOOST_CHECK ( ba::none_of_equal ( vi.begin() + 2, vi.end(), 5 ));
BOOST_CHECK ( ba::none_of ( vi.begin() + 2, vi.end(), is_<int> ( 5 )));
BOOST_CHECK (!ba::none_of_equal ( vi.begin() + 2, vi.end(), 1 ));
BOOST_CHECK (!ba::none_of ( vi.begin() + 2, vi.end(), is_<int> ( 1 )));
// 18 is not in { 1, 5, 0 }, but 5 is
BOOST_CHECK ( ba::none_of_equal ( vi.begin(), vi.begin() + 3, 18 ));
BOOST_CHECK ( ba::none_of ( vi.begin(), vi.begin() + 3, is_<int> ( 18 )));
BOOST_CHECK (!ba::none_of_equal ( vi.begin(), vi.begin() + 3, 5 ));
BOOST_CHECK (!ba::none_of ( vi.begin(), vi.begin() + 3, is_<int> ( 5 )));
BOOST_CHECK ( ba::none_of_equal ( vc, 'z' ));
BOOST_CHECK ( ba::none_of ( vc, is_<char> ( 'z' )));
BOOST_CHECK (!ba::none_of_equal ( vc, 'a' ));
BOOST_CHECK (!ba::none_of ( vc, is_<char> ( 'a' )));
BOOST_CHECK (!ba::none_of_equal ( vc, 'n' ));
BOOST_CHECK (!ba::none_of ( vc, is_<char> ( 'n' )));
BOOST_CHECK ( ba::none_of_equal ( vi.begin(), vi.begin(), 1 ));
BOOST_CHECK ( ba::none_of_equal ( vc.begin(), vc.begin(), 'a' ));
BOOST_CHECK ( ba::none_of ( vi.begin(), vi.begin(), is_<int> ( 1 )));
BOOST_CHECK ( ba::none_of ( vc.begin(), vc.begin(), is_<char> ( 'a' )));
BOOST_CHECK ( ba::none_of_equal ( li, 100 ));
BOOST_CHECK ( ba::none_of ( li, is_<int> ( 100 )));
BOOST_CHECK ( ba::none_of_equal ( li.begin(), li.end(), 100 ));
BOOST_CHECK ( ba::none_of ( li.begin(), li.end(), is_<int> ( 100 )));
std::list<int>::iterator l_iter = li.begin ();
l_iter++; l_iter++; l_iter++;
BOOST_CHECK ( ba::none_of_equal ( li.begin(), l_iter, 18 ));
BOOST_CHECK ( ba::none_of ( li.begin(), l_iter, is_<int> ( 18 )));
BOOST_CHECK (!ba::none_of ( li.begin(), l_iter, is_<int> ( 5 )));
}
int test_main( int , char* [] )
{
test_none();
return 0;
}

101
test/one_of_test.cpp Normal file
View File

@@ -0,0 +1,101 @@
/*
Copyright (c) Marshall Clow 2008-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
For more information, see http://www.boost.org
*/
#include <boost/config.hpp>
#include <boost/algorithm/cxx11/one_of.hpp>
#include <boost/test/included/test_exec_monitor.hpp>
#include <functional>
#include <vector>
#include <list>
template<typename T>
struct is_ : public std::unary_function<T, bool> {
is_ ( T v ) : val_ ( v ) {}
~is_ () {}
bool operator () ( T comp ) const { return val_ == comp; }
private:
is_ (); // need a value
T val_;
};
namespace ba = boost::algorithm;
void test_one ()
{
// Note: The literal values here are tested against directly, careful if you change them:
int some_numbers[] = { 1, 1, 2, 3, 5 };
std::vector<int> vi(some_numbers, some_numbers + 5);
std::list<int> li(vi.begin(), vi.end ());
int some_letters[] = { 'a', 'q', 'n', 'y', 'n' };
std::vector<char> vc(some_letters, some_letters + 5);
BOOST_CHECK (!ba::one_of_equal ( vi, 1 ));
BOOST_CHECK (!ba::one_of ( vi, is_<int> ( 1 )));
BOOST_CHECK (!ba::one_of_equal ( vi.begin(), vi.end(), 1 ));
BOOST_CHECK (!ba::one_of ( vi.begin(), vi.end(), is_<int> ( 1 )));
BOOST_CHECK (!ba::one_of_equal ( vi, 0 ));
BOOST_CHECK (!ba::one_of ( vi, is_<int> ( 0 )));
BOOST_CHECK (!ba::one_of_equal ( vi.begin(), vi.end(), 0 ));
BOOST_CHECK (!ba::one_of ( vi.begin(), vi.end(), is_<int> ( 0 )));
BOOST_CHECK ( ba::one_of_equal ( vi, 2 ));
BOOST_CHECK ( ba::one_of ( vi, is_<int> ( 2 )));
BOOST_CHECK ( ba::one_of_equal ( vi.begin(), vi.end(), 2 ));
BOOST_CHECK ( ba::one_of ( vi.begin(), vi.end(), is_<int> ( 2 )));
// Check for a match at the end
BOOST_CHECK ( ba::one_of_equal ( vi, 5 ));
BOOST_CHECK ( ba::one_of ( vi, is_<int> ( 5 )));
BOOST_CHECK ( ba::one_of_equal ( vi.begin(), vi.end(), 5 ));
BOOST_CHECK ( ba::one_of ( vi.begin(), vi.end(), is_<int> ( 5 )));
BOOST_CHECK ( ba::one_of_equal ( vi.begin() + 1, vi.end(), 1 ));
BOOST_CHECK ( ba::one_of ( vi.begin() + 1, vi.end(), is_<int> ( 1 )));
BOOST_CHECK ( ba::one_of_equal ( vc.begin() + 1, vc.begin() + 2, 'q' ));
BOOST_CHECK ( ba::one_of ( vc.begin() + 1, vc.begin() + 2, is_<char> ( 'q' )));
BOOST_CHECK (!ba::one_of_equal ( vc, '!' ));
BOOST_CHECK (!ba::one_of ( vc, is_<char> ( '!' )));
BOOST_CHECK (!ba::one_of_equal ( vc, 'n' ));
BOOST_CHECK (!ba::one_of ( vc, is_<char> ( 'n' )));
// Empty range check
BOOST_CHECK (!ba::one_of_equal ( vi.begin(), vi.begin(), 1 ));
BOOST_CHECK (!ba::one_of_equal ( vc.begin(), vc.begin(), 'a' ));
BOOST_CHECK (!ba::one_of ( vi.begin(), vi.begin(), is_<int> ( 1 )));
BOOST_CHECK (!ba::one_of ( vc.begin(), vc.begin(), is_<char> ( 'a' )));
BOOST_CHECK (!ba::one_of_equal ( li, 1 ));
BOOST_CHECK (!ba::one_of ( li, is_<int> ( 1 )));
BOOST_CHECK (!ba::one_of_equal ( li.begin(), li.end(), 1 ));
BOOST_CHECK (!ba::one_of ( li.begin(), li.end(), is_<int> ( 1 )));
std::list<int>::iterator l_iter = li.begin ();
l_iter++; l_iter++; l_iter++;
BOOST_CHECK (!ba::one_of_equal ( li.begin(), l_iter, 1 ));
BOOST_CHECK (!ba::one_of ( li.begin(), l_iter, is_<int> ( 1 )));
BOOST_CHECK ( ba::one_of_equal ( li.begin(), l_iter, 2 ));
BOOST_CHECK ( ba::one_of ( li.begin(), l_iter, is_<int> ( 2 )));
BOOST_CHECK (!ba::one_of_equal ( li.begin(), l_iter, 3 ));
BOOST_CHECK (!ba::one_of ( li.begin(), l_iter, is_<int> ( 3 )));
}
int test_main( int , char* [] )
{
test_one ();
return 0;
}

127
test/ordered_test.cpp Normal file
View File

@@ -0,0 +1,127 @@
// Copyright (c) 2010 Nuovation System Designs, LLC
// Grant Erickson <gerickson@nuovations.com>
//
// Reworked by Marshall Clow; August 2010
//
// Distributed under the Boost Software License, Version 1.0. (See
// accompanying file LICENSE_1_0.txt or copy at
// http://www.boost.org/LICENSE_1_0.txt)
//
// See http://www.boost.org/ for latest version.
#include <algorithm>
#include <iostream>
#include <boost/algorithm/cxx11/ordered.hpp>
#include <boost/test/included/test_exec_monitor.hpp>
using namespace boost;
/* Preprocessor Defines */
#define elementsof(v) (sizeof (v) / sizeof (v[0]))
#define a_begin(v) (&v[0])
#define a_end(v) (v + elementsof (v))
#define a_range(v) v
#define b_e(v) a_begin(v),a_end(v)
namespace ba = boost::algorithm;
static void
test_ordered(void)
{
const int strictlyIncreasingValues[] = { 1, 2, 3, 4, 5 };
const int strictlyDecreasingValues[] = { 9, 8, 7, 6, 5 };
const int increasingValues[] = { 1, 2, 2, 2, 5 };
const int decreasingValues[] = { 9, 7, 7, 7, 5 };
const int randomValues[] = { 3, 6, 1, 2, 7 };
const int constantValues[] = { 7, 7, 7, 7, 7 };
int nonConstantArray[] = { 7, 7, 7, 7, 7 };
const int inOrderUntilTheEnd [] = { 0, 1, 2, 3, 4, 5, 6, 7, 6 };
// Test a strictly increasing sequence
BOOST_CHECK ( ba::is_strictly_increasing (b_e(strictlyIncreasingValues)));
BOOST_CHECK ( ba::is_increasing (b_e(strictlyIncreasingValues)));
BOOST_CHECK ( !ba::is_strictly_decreasing (b_e(strictlyIncreasingValues)));
BOOST_CHECK ( !ba::is_decreasing (b_e(strictlyIncreasingValues)));
BOOST_CHECK ( ba::is_strictly_increasing (a_range(strictlyIncreasingValues)));
BOOST_CHECK ( ba::is_increasing (a_range(strictlyIncreasingValues)));
BOOST_CHECK ( !ba::is_strictly_decreasing (a_range(strictlyIncreasingValues)));
BOOST_CHECK ( !ba::is_decreasing (a_range(strictlyIncreasingValues)));
// Test a strictly decreasing sequence
BOOST_CHECK ( !ba::is_strictly_increasing (b_e(strictlyDecreasingValues)));
BOOST_CHECK ( !ba::is_increasing (b_e(strictlyDecreasingValues)));
BOOST_CHECK ( ba::is_strictly_decreasing (b_e(strictlyDecreasingValues)));
BOOST_CHECK ( ba::is_decreasing (b_e(strictlyDecreasingValues)));
// Test an increasing sequence
BOOST_CHECK ( !ba::is_strictly_increasing (b_e(increasingValues)));
BOOST_CHECK ( ba::is_increasing (b_e(increasingValues)));
BOOST_CHECK ( !ba::is_strictly_decreasing (b_e(increasingValues)));
BOOST_CHECK ( !ba::is_decreasing (b_e(increasingValues)));
// Test a decreasing sequence
BOOST_CHECK ( !ba::is_strictly_increasing (b_e(decreasingValues)));
BOOST_CHECK ( !ba::is_increasing (b_e(decreasingValues)));
BOOST_CHECK ( !ba::is_strictly_decreasing (b_e(decreasingValues)));
BOOST_CHECK ( ba::is_decreasing (b_e(decreasingValues)));
// Test a random sequence
BOOST_CHECK ( !ba::is_strictly_increasing (b_e(randomValues)));
BOOST_CHECK ( !ba::is_increasing (b_e(randomValues)));
BOOST_CHECK ( !ba::is_strictly_decreasing (b_e(randomValues)));
BOOST_CHECK ( !ba::is_decreasing (b_e(randomValues)));
// Test a constant sequence
BOOST_CHECK ( !ba::is_strictly_increasing (b_e(constantValues)));
BOOST_CHECK ( ba::is_increasing (b_e(constantValues)));
BOOST_CHECK ( !ba::is_strictly_decreasing (b_e(constantValues)));
BOOST_CHECK ( ba::is_decreasing (b_e(constantValues)));
// Test an empty sequence
BOOST_CHECK ( ba::is_strictly_increasing (strictlyIncreasingValues, strictlyIncreasingValues));
BOOST_CHECK ( ba::is_increasing (strictlyIncreasingValues, strictlyIncreasingValues));
BOOST_CHECK ( ba::is_strictly_decreasing (strictlyIncreasingValues, strictlyIncreasingValues));
BOOST_CHECK ( ba::is_decreasing (strictlyIncreasingValues, strictlyIncreasingValues));
// Test a one-element sequence
BOOST_CHECK ( ba::is_strictly_increasing (strictlyIncreasingValues, strictlyIncreasingValues+1));
BOOST_CHECK ( ba::is_increasing (strictlyIncreasingValues, strictlyIncreasingValues+1));
BOOST_CHECK ( ba::is_strictly_decreasing (strictlyIncreasingValues, strictlyIncreasingValues+1));
BOOST_CHECK ( ba::is_decreasing (strictlyIncreasingValues, strictlyIncreasingValues+1));
// Test a two-element sequence
BOOST_CHECK ( ba::is_strictly_increasing (strictlyIncreasingValues, strictlyIncreasingValues+2));
BOOST_CHECK ( ba::is_increasing (strictlyIncreasingValues, strictlyIncreasingValues+2));
BOOST_CHECK ( !ba::is_strictly_decreasing (strictlyIncreasingValues, strictlyIncreasingValues+2));
BOOST_CHECK ( !ba::is_decreasing (strictlyIncreasingValues, strictlyIncreasingValues+2));
// Test underlying routines
BOOST_CHECK ( ba::is_sorted_until ( b_e(strictlyIncreasingValues), std::less<int>()) == a_end(strictlyIncreasingValues));
BOOST_CHECK ( ba::is_sorted_until ( a_range(strictlyIncreasingValues), std::less<int>()) == boost::end(strictlyIncreasingValues));
BOOST_CHECK ( ba::is_sorted_until ( b_e(nonConstantArray), std::less<int>()) != a_end(nonConstantArray));
BOOST_CHECK ( ba::is_sorted_until ( a_range(nonConstantArray), std::less<int>()) != boost::end(nonConstantArray));
BOOST_CHECK ( ba::is_sorted_until ( b_e(randomValues), std::less<int>()) == &randomValues[2] );
BOOST_CHECK ( ba::is_sorted_until ( a_range(randomValues), std::less<int>()) == &randomValues[2] );
BOOST_CHECK ( ba::is_sorted_until ( b_e(randomValues), std::less<int>()) == &randomValues[2] );
BOOST_CHECK ( ba::is_sorted_until ( a_range(randomValues), std::less<int>()) == &randomValues[2] );
BOOST_CHECK ( ba::is_sorted_until ( a_range(inOrderUntilTheEnd), std::less<int>()) == &inOrderUntilTheEnd[8] );
// For zero and one element collections, the comparison predicate should never be called
BOOST_CHECK ( ba::is_sorted_until ( a_begin(randomValues), a_begin(randomValues), std::equal_to<int>()) == a_begin(randomValues));
BOOST_CHECK ( ba::is_sorted_until ( a_begin(randomValues), a_begin(randomValues) + 1, std::equal_to<int>()) == a_begin(randomValues) + 1);
}
int test_main( int, char * [] )
{
test_ordered ();
return 0;
}

View File

@@ -0,0 +1,87 @@
/*
Copyright (c) Marshall Clow 2011-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
For more information, see http://www.boost.org
*/
#include <iostream>
#include <boost/config.hpp>
#include <boost/algorithm/cxx11/partition_copy.hpp>
#include <boost/test/included/test_exec_monitor.hpp>
#include <boost/algorithm/cxx11/all_of.hpp>
#include <boost/algorithm/cxx11/none_of.hpp>
#include <string>
#include <vector>
#include <list>
namespace ba = boost::algorithm;
// namespace ba = boost;
template <typename Container, typename Predicate>
void test_sequence ( const Container &c, Predicate comp ) {
std::vector<typename Container::value_type> v1, v2;
v1.clear (); v2.clear ();
ba::partition_copy ( c.begin (), c.end (),
std::back_inserter (v1), std::back_inserter (v2), comp );
// std::cout << "Sizes(1): " << c.size () << " -> { " << v1.size () << ", " << v2.size () << " }" << std::endl;
BOOST_CHECK ( v1.size () + v2.size () == c.size ());
BOOST_CHECK ( ba::all_of ( v1.begin (), v1.end (), comp ));
BOOST_CHECK ( ba::none_of ( v2.begin (), v2.end (), comp ));
v1.clear (); v2.clear ();
ba::partition_copy ( c, std::back_inserter (v1), std::back_inserter ( v2 ), comp );
// std::cout << "Sizes(2): " << c.size () << " -> { " << v1.size () << ", " << v2.size () << " }" << std::endl;
BOOST_CHECK ( v1.size () + v2.size () == c.size ());
BOOST_CHECK ( ba::all_of ( v1, comp ));
BOOST_CHECK ( ba::none_of ( v2, comp ));
}
template <typename T>
struct less_than {
public:
less_than ( T foo ) : val ( foo ) {}
less_than ( const less_than &rhs ) : val ( rhs.val ) {}
bool operator () ( const T &v ) const { return v < val; }
private:
less_than ();
less_than operator = ( const less_than &rhs );
T val;
};
bool is_even ( int v ) { return v % 2 == 0; }
void test_sequence1 () {
std::vector<int> v;
v.clear ();
for ( int i = 5; i < 15; ++i )
v.push_back ( i );
test_sequence ( v, less_than<int>(3)); // no elements
test_sequence ( v, less_than<int>(6)); // only the first element
test_sequence ( v, less_than<int>(10));
test_sequence ( v, less_than<int>(99)); // all elements satisfy
// With bidirectional iterators.
std::list<int> l;
for ( int i = 5; i < 16; ++i )
l.push_back ( i );
test_sequence ( l, less_than<int>(3)); // no elements
test_sequence ( l, less_than<int>(6)); // only the first element
test_sequence ( l, less_than<int>(10));
test_sequence ( l, less_than<int>(99)); // all elements satisfy
}
int test_main( int , char* [] )
{
test_sequence1 ();
return 0;
}

View File

@@ -0,0 +1,98 @@
/*
Copyright (c) Marshall Clow 2011-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
For more information, see http://www.boost.org
*/
#include <iostream>
#include <boost/config.hpp>
#include <boost/algorithm/cxx11/partition_point.hpp>
#include <boost/test/included/test_exec_monitor.hpp>
#include <string>
#include <vector>
#include <list>
namespace ba = boost::algorithm;
// namespace ba = boost;
template <typename Container>
typename Container::iterator offset_to_iter ( Container &v, int offset ) {
typename Container::iterator retval;
if ( offset >= 0 ) {
retval = v.begin ();
std::advance ( retval, offset );
}
else {
retval = v.end ();
std::advance ( retval, offset + 1 );
}
return retval;
}
template <typename Container, typename Predicate>
void test_sequence ( Container &v, Predicate comp, int expected ) {
typename Container::iterator res, exp;
res = ba::partition_point ( v.begin (), v.end (), comp );
exp = offset_to_iter ( v, expected );
std::cout << "Expected(1): " << std::distance ( v.begin (), exp )
<< ", got: " << std::distance ( v.begin (), res ) << std::endl;
BOOST_CHECK ( exp == res );
// Duplicate the last element; this checks for any even/odd problems
v.push_back ( * v.rbegin ());
res = ba::partition_point ( v.begin (), v.end (), comp );
exp = offset_to_iter ( v, expected );
std::cout << "Expected(2): " << std::distance ( v.begin (), exp )
<< ", got: " << std::distance ( v.begin (), res ) << std::endl;
BOOST_CHECK ( exp == res );
}
template <typename T>
struct less_than {
public:
less_than ( T foo ) : val ( foo ) {}
less_than ( const less_than &rhs ) : val ( rhs.val ) {}
bool operator () ( const T &v ) const { return v < val; }
private:
less_than ();
less_than operator = ( const less_than &rhs );
T val;
};
void test_sequence1 () {
std::vector<int> v;
v.clear ();
for ( int i = 5; i < 15; ++i )
v.push_back ( i );
test_sequence ( v, less_than<int>(3), 0 ); // no elements
test_sequence ( v, less_than<int>(6), 1 ); // only the first element
test_sequence ( v, less_than<int>(10), 5 );
test_sequence ( v, less_than<int>(99), -1 ); // all elements satisfy
// With bidirectional iterators.
std::list<int> l;
for ( int i = 5; i < 15; ++i )
l.push_back ( i );
test_sequence ( l, less_than<int>(3), 0 ); // no elements
test_sequence ( l, less_than<int>(6), 1 ); // only the first element
test_sequence ( l, less_than<int>(10), 5 );
test_sequence ( l, less_than<int>(99), -1 ); // all elements satisfy
}
int test_main( int , char* [] )
{
test_sequence1 ();
return 0;
}

26
test/search_fail1.cpp Normal file
View File

@@ -0,0 +1,26 @@
/*
Copyright (c) Marshall Clow 2010-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
For more information, see http://www.boost.org
*/
#include <vector>
#include <boost/algorithm/searching/boyer_moore.hpp>
int main( int argc, char *argv [] )
{
std::vector<char> cv;
std::vector<int> iv;
// Should fail to compile because the underlying types are different
// They are (almost certainly) different sizes
(void) boost::algorithm::boyer_moore_search (
cv.begin (), cv.end (), iv.begin (), iv.end ());
(void) argv; (void) argc;
return 0;
}

27
test/search_fail2.cpp Normal file
View File

@@ -0,0 +1,27 @@
/*
Copyright (c) Marshall Clow 2010-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
For more information, see http://www.boost.org
*/
#include <vector>
#include <boost/cstdint.hpp>
#include <boost/algorithm/searching/boyer_moore.hpp>
int main( int argc, char *argv [] )
{
std::vector<boost::uint8_t> cv;
std::vector<boost:: int8_t> iv;
// Should fail to compile because the underlying types are different
// They are the same size, but one is signed, and the other is not.
(void) boost::algorithm::boyer_moore_search (
cv.begin (), cv.end (), iv.begin (), iv.end ());
(void) argv; (void) argc;
return 0;
}

20
test/search_fail3.cpp Normal file
View File

@@ -0,0 +1,20 @@
/*
Copyright (c) Marshall Clow 2010-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
For more information, see http://www.boost.org
*/
#include <vector>
#include <boost/algorithm/searching/boyer_moore.hpp>
int main( int argc, char *argv [] )
{
// Should fail to compile because the search objects are not default-constructible
boost::algorithm::boyer_moore<std::vector<char>::iterator> bm;
(void) argv; (void) argc;
return 0;
}

272
test/search_test1.cpp Executable file
View File

@@ -0,0 +1,272 @@
/*
Copyright (c) Marshall Clow 2010-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
For more information, see http://www.boost.org
*/
#include <boost/algorithm/searching/boyer_moore.hpp>
#include <boost/algorithm/searching/boyer_moore_horspool.hpp>
#include <boost/algorithm/searching/knuth_morris_pratt.hpp>
#include <boost/test/included/test_exec_monitor.hpp>
#include <iostream>
#include <string>
#include <vector>
namespace ba = boost::algorithm;
template <typename Iter>
std::string make_str ( Iter first, std::size_t len ) {
std::string retVal ( len + 2, '\'' );
std::copy ( first, first+len, retVal.begin () + 1);
return retVal;
}
namespace {
// Check using iterators
template<typename Container>
void check_one_iter ( const Container &haystack, const std::string &needle, int expected ) {
typedef typename Container::const_iterator iter_type;
typedef std::string::const_iterator pattern_type;
iter_type hBeg = haystack.begin ();
iter_type hEnd = haystack.end ();
pattern_type nBeg = needle.begin ();
pattern_type nEnd = needle.end ();
iter_type it0 = std::search (hBeg, hEnd, nBeg, nEnd);
iter_type it1 = ba::boyer_moore_search (hBeg, hEnd, nBeg, nEnd);
iter_type it1r = ba::boyer_moore_search (haystack, nBeg, nEnd);
iter_type it2 = ba::boyer_moore_horspool_search (hBeg, hEnd, nBeg, nEnd);
iter_type it3 = ba::knuth_morris_pratt_search (hBeg, hEnd, nBeg, nEnd);
const int dist = it1 == hEnd ? -1 : std::distance ( hBeg, it1 );
std::cout << "(Iterators) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl;
try {
if ( it0 != it1 ) {
throw std::runtime_error (
std::string ( "results mismatch between std::search and boyer-moore search" ));
}
if ( it1 != it1r ) {
throw std::runtime_error (
std::string ( "results mismatch between iterator and range boyer_moore search" ));
}
if ( it1 != it2 ) {
throw std::runtime_error (
std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" ));
}
if ( it1 != it3 )
throw std::runtime_error (
std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" ));
}
catch ( ... ) {
std::cout << "Searching for: " << needle << std::endl;
std::cout << "Expected: " << expected << "\n";
std::cout << " std: " << std::distance ( hBeg, it0 ) << "\n";
std::cout << " bm: " << std::distance ( hBeg, it1 ) << "\n";
std::cout << " bm(r): " << std::distance ( hBeg, it1r ) << "\n";
std::cout << " bmh: " << std::distance ( hBeg, it2 ) << "\n";
std::cout << " kpm: " << std::distance ( hBeg, it3 )<< "\n";
std::cout << std::flush;
throw ;
}
BOOST_CHECK_EQUAL ( dist, expected );
}
// Check using pointers
// We're assuming that the container implements contiguous storage here.
template<typename Container>
void check_one_pointer ( const Container &haystack, const std::string &needle, int expected ) {
typedef const typename Container::value_type *ptr_type;
ptr_type hBeg = haystack.size () == 0 ? NULL : &*haystack.begin ();
ptr_type hEnd = hBeg + haystack.size ();
ptr_type nBeg = needle.size () == 0 ? NULL : &*needle.begin ();
ptr_type nEnd = nBeg + needle.size ();
ptr_type it0 = std::search (hBeg, hEnd, nBeg, nEnd);
ptr_type it1 = ba::boyer_moore_search (hBeg, hEnd, nBeg, nEnd);
ptr_type it2 = ba::boyer_moore_horspool_search (hBeg, hEnd, nBeg, nEnd);
ptr_type it3 = ba::knuth_morris_pratt_search (hBeg, hEnd, nBeg, nEnd);
const int dist = it1 == hEnd ? -1 : std::distance ( hBeg, it1 );
std::cout << "(Pointers) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl;
try {
if ( it0 != it1 ) {
throw std::runtime_error (
std::string ( "results mismatch between std::search and boyer-moore search" ));
}
if ( it1 != it2 ) {
throw std::runtime_error (
std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" ));
}
if ( it1 != it3 )
throw std::runtime_error (
std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" ));
}
catch ( ... ) {
std::cout << "Searching for: " << needle << std::endl;
std::cout << "Expected: " << expected << "\n";
std::cout << " std: " << std::distance ( hBeg, it0 ) << "\n";
std::cout << " bm: " << std::distance ( hBeg, it1 ) << "\n";
std::cout << " bmh: " << std::distance ( hBeg, it2 ) << "\n";
std::cout << " kpm: " << std::distance ( hBeg, it3 )<< "\n";
std::cout << std::flush;
throw ;
}
BOOST_CHECK_EQUAL ( dist, expected );
}
// Check using objects
template<typename Container>
void check_one_object ( const Container &haystack, const std::string &needle, int expected ) {
typedef typename Container::const_iterator iter_type;
typedef std::string::const_iterator pattern_type;
iter_type hBeg = haystack.begin ();
iter_type hEnd = haystack.end ();
pattern_type nBeg = needle.begin ();
pattern_type nEnd = needle.end ();
ba::boyer_moore<pattern_type> bm_r = ba::make_boyer_moore ( needle );
ba::boyer_moore<pattern_type> bm ( nBeg, nEnd );
ba::boyer_moore_horspool<pattern_type> bmh ( nBeg, nEnd );
ba::knuth_morris_pratt<pattern_type> kmp ( nBeg, nEnd );
iter_type it0 = std::search (hBeg, hEnd, nBeg, nEnd);
iter_type it1 = bm (hBeg, hEnd);
iter_type it1r = bm (haystack);
iter_type rt1 = bm_r (hBeg, hEnd);
iter_type rt1r = bm_r (haystack);
iter_type it2 = bmh (hBeg, hEnd);
iter_type it3 = kmp (hBeg, hEnd);
const int dist = it1 == hEnd ? -1 : std::distance ( hBeg, it1 );
std::cout << "(Objects) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl;
try {
if ( it0 != it1 ) {
throw std::runtime_error (
std::string ( "results mismatch between std::search and boyer-moore search" ));
}
if ( it1 != it1r ) {
throw std::runtime_error (
std::string ( "results mismatch between iterator and range boyer_moore search(1)" ));
}
if ( it1 != rt1 ) {
throw std::runtime_error (
std::string ( "results mismatch between iterator and range boyer_moore search(2)" ));
}
if ( rt1 != rt1r ) {
throw std::runtime_error (
std::string ( "results mismatch between iterator and range boyer_moore search(3)" ));
}
if ( it1 != it2 ) {
throw std::runtime_error (
std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" ));
}
if ( it1 != it3 )
throw std::runtime_error (
std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" ));
}
catch ( ... ) {
std::cout << "Searching for: " << needle << std::endl;
std::cout << "Expected: " << expected << "\n";
std::cout << " std: " << std::distance ( hBeg, it0 ) << "\n";
std::cout << " bm: " << std::distance ( hBeg, it1 ) << "\n";
std::cout << " bm(r1): " << std::distance ( hBeg, it1r ) << "\n";
std::cout << " bm(r2): " << std::distance ( hBeg, rt1 ) << "\n";
std::cout << " bm(r3): " << std::distance ( hBeg, rt1r ) << "\n";
std::cout << " bmh: " << std::distance ( hBeg, it2 ) << "\n";
std::cout << " kpm: " << std::distance ( hBeg, it3 )<< "\n";
std::cout << std::flush;
throw ;
}
BOOST_CHECK_EQUAL ( dist, expected );
}
template<typename Container>
void check_one ( const Container &haystack, const std::string &needle, int expected ) {
check_one_iter ( haystack, needle, expected );
check_one_pointer ( haystack, needle, expected );
check_one_object ( haystack, needle, expected );
}
}
int test_main( int , char* [] )
{
std::string haystack1 ( "NOW AN FOWE\220ER ANNMAN THE ANPANMANEND" );
std::string needle1 ( "ANPANMAN" );
std::string needle2 ( "MAN THE" );
std::string needle3 ( "WE\220ER" );
std::string needle4 ( "NOW " ); // At the beginning
std::string needle5 ( "NEND" ); // At the end
std::string needle6 ( "NOT FOUND" ); // Nowhere
std::string needle7 ( "NOT FO\340ND" ); // Nowhere
std::string haystack2 ( "ABC ABCDAB ABCDABCDABDE" );
std::string needle11 ( "ABCDABD" );
std::string haystack3 ( "abra abracad abracadabra" );
std::string needle12 ( "abracadabra" );
std::string needle13 ( "" );
std::string haystack4 ( "" );
check_one ( haystack1, needle1, 26 );
check_one ( haystack1, needle2, 18 );
check_one ( haystack1, needle3, 9 );
check_one ( haystack1, needle4, 0 );
check_one ( haystack1, needle5, 33 );
check_one ( haystack1, needle6, -1 );
check_one ( haystack1, needle7, -1 );
check_one ( needle1, haystack1, -1 ); // cant find long pattern in short corpus
check_one ( haystack1, haystack1, 0 ); // find something in itself
check_one ( haystack2, haystack2, 0 ); // find something in itself
check_one ( haystack2, needle11, 15 );
check_one ( haystack3, needle12, 13 );
check_one ( haystack1, needle13, 0 ); // find the empty string
check_one ( haystack4, needle1, -1 ); // can't find in an empty haystack
// Mikhail Levin <svarneticist@gmail.com> found a problem, and this was the test
// that triggered it.
const std::string mikhail_pattern =
"GATACACCTACCTTCACCAGTTACTCTATGCACTAGGTGCGCCAGGCCCATGCACAAGGGCTTGAGTGGATGGGAAGGA"
"TGTGCCCTAGTGATGGCAGCATAAGCTACGCAGAGAAGTTCCAGGGCAGAGTCACCATGACCAGGGACACATCCACGAG"
"CACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCCATGTATTACTGTGGGAGAGATGTCTGGAGTGGT"
"TATTATTGCCCCGGTAATATTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACG"
;
const std::string mikhail_corpus = std::string (8, 'a') + mikhail_pattern;
check_one ( mikhail_corpus, mikhail_pattern, 8 );
return 0;
}

145
test/search_test2.cpp Executable file
View File

@@ -0,0 +1,145 @@
/*
Copyright (c) Marshall Clow 2010-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
For more information, see http://www.boost.org
*/
#include <boost/algorithm/searching/boyer_moore.hpp>
#include <boost/algorithm/searching/boyer_moore_horspool.hpp>
#include <boost/algorithm/searching/knuth_morris_pratt.hpp>
#include <boost/test/included/test_exec_monitor.hpp>
#include <iostream>
#include <algorithm>
#include <vector>
typedef std::vector<char> vec;
#define NUM_TRIES 100
#define runOne(call, refDiff) { \
std::clock_t bTime, eTime; \
bTime = std::clock (); \
for ( i = 0; i < NUM_TRIES; ++i ) { \
res = boost::algorithm::call \
( haystack.begin (), haystack.end (), \
needle.begin (), needle.end ()); \
if ( res != exp ) { \
std::cout << "On run # " << i << " expected " \
<< exp - haystack.begin () << " got " \
<< res - haystack.begin () << std::endl; \
throw std::runtime_error \
( "Unexpected result from " #call ); \
} \
} \
eTime = std::clock (); \
printRes ( #call, eTime - bTime, refDiff ); }
#define runObject(obj, refDiff) { \
std::clock_t bTime, eTime; \
bTime = std::clock (); \
boost::algorithm::obj <vec::const_iterator> \
s_o ( needle.begin (), needle.end ()); \
for ( i = 0; i < NUM_TRIES; ++i ) { \
res = s_o ( haystack.begin (), haystack.end ()); \
if ( res != exp ) { \
std::cout << "On run # " << i << " expected " \
<< exp - haystack.begin () << " got " \
<< res - haystack.begin () << std::endl; \
throw std::runtime_error \
( "Unexpected result from " #obj " object" ); \
} \
} \
eTime = std::clock (); \
printRes ( #obj " object", eTime - bTime, refDiff ); }
namespace {
vec ReadFromFile ( const char *name ) {
std::ifstream in ( name, std::ios_base::binary | std::ios_base::in );
vec retVal;
std::istream_iterator<char, char> begin(in);
std::istream_iterator<char, char> end;
std::copy ( begin, end, std::back_inserter ( retVal ));
return retVal;
}
void printRes ( const char *prompt, unsigned long diff, unsigned long stdDiff ) {
std::cout
<< std::setw(34) << prompt << " "
<< std::setw(6) << ( 1.0 * diff) / CLOCKS_PER_SEC << " seconds\t"
<< std::setw(5) << (100.0 * diff) / stdDiff << "% \t"
<< std::setw(12) << diff;
if ( diff > stdDiff )
std::cout << " !!";
std::cout << std::endl;
}
void check_one ( const vec &haystack, const vec &needle, int expected ) {
std::size_t i;
std::clock_t sTime;
unsigned long stdDiff;
vec::const_iterator res;
vec::const_iterator exp; // the expected result
if ( expected >= 0 )
exp = haystack.begin () + expected;
else if ( expected == -1 )
exp = haystack.end (); // we didn't find it!
else if ( expected == -2 )
exp = std::search ( haystack.begin (), haystack.end (), needle.begin (), needle.end ());
else
throw std::logic_error ( "Expected must be -2, -1, or >= 0" );
std::cout << "Pattern is " << needle.size () << " entries long" << std::endl;
std::cout << "Corpus is " << haystack.size () << " entries long" << std::endl;
// First, the std library search
sTime = std::clock ();
for ( i = 0; i < NUM_TRIES; ++i ) {
res = std::search ( haystack.begin (), haystack.end (), needle.begin (), needle.end ());
if ( res != exp ) {
std::cout << "On run # " << i << " expected " << exp - haystack.begin () << " got " << res - haystack.begin () << std::endl;
throw std::runtime_error ( "Unexpected result from std::search" );
}
}
stdDiff = std::clock () - sTime;
printRes ( "std::search", stdDiff, stdDiff );
runOne ( boyer_moore_search, stdDiff );
runObject ( boyer_moore, stdDiff );
runOne ( boyer_moore_horspool_search, stdDiff );
runObject ( boyer_moore_horspool, stdDiff );
runOne ( knuth_morris_pratt_search, stdDiff );
runObject ( knuth_morris_pratt, stdDiff );
}
}
int test_main( int , char* [] )
{
vec c1 = ReadFromFile ( "search_test_data/0001.corpus" );
vec p1b = ReadFromFile ( "search_test_data/0001b.pat" );
vec p1e = ReadFromFile ( "search_test_data/0001e.pat" );
vec p1n = ReadFromFile ( "search_test_data/0001n.pat" );
vec p1f = ReadFromFile ( "search_test_data/0001f.pat" );
std::cout << std::ios::fixed << std::setprecision(4);
// std::cout << "Corpus is " << c1.size () << " entries long\n";
std::cout << "--- Beginning ---" << std::endl;
check_one ( c1, p1b, 0 ); // Find it at position zero
std::cout << "---- Middle -----" << std::endl;
check_one ( c1, p1f, -2 ); // Don't know answer
std::cout << "------ End ------" << std::endl;
check_one ( c1, p1e, c1.size() - p1e.size ());
std::cout << "--- Not found ---" << std::endl;
check_one ( c1, p1n, -1 ); // Not found
return 0;
}

145
test/search_test3.cpp Executable file
View File

@@ -0,0 +1,145 @@
/*
Copyright (c) Marshall Clow 2010-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
For more information, see http://www.boost.org
*/
#include <boost/algorithm/searching/boyer_moore.hpp>
#include <boost/algorithm/searching/boyer_moore_horspool.hpp>
#include <boost/algorithm/searching/knuth_morris_pratt.hpp>
#include <boost/test/included/test_exec_monitor.hpp>
#include <iostream>
#include <algorithm>
#include <vector>
#include <string>
typedef std::vector<std::string> vec;
#define NUM_TRIES 100
#define runOne(call, refDiff) { \
std::clock_t bTime, eTime; \
bTime = std::clock (); \
for ( i = 0; i < NUM_TRIES; ++i ) { \
res = boost::algorithm::call \
( haystack.begin (), haystack.end (), \
needle.begin (), needle.end ()); \
if ( res != exp ) { \
std::cout << "On run # " << i << " expected " \
<< exp - haystack.begin () << " got " \
<< res - haystack.begin () << std::endl; \
throw std::runtime_error \
( "Unexpected result from " #call ); \
} \
} \
eTime = std::clock (); \
printRes ( #call, eTime - bTime, refDiff ); }
#define runObject(obj, refDiff) { \
std::clock_t bTime, eTime; \
bTime = std::clock (); \
boost::algorithm::obj <vec::const_iterator> \
s_o ( needle.begin (), needle.end ()); \
for ( i = 0; i < NUM_TRIES; ++i ) { \
res = s_o ( haystack.begin (), haystack.end ()); \
if ( res != exp ) { \
std::cout << "On run # " << i << " expected " \
<< exp - haystack.begin () << " got " \
<< res - haystack.begin () << std::endl; \
throw std::runtime_error \
( "Unexpected result from " #obj " object" ); \
} \
} \
eTime = std::clock (); \
printRes ( #obj " object", eTime - bTime, refDiff ); }
namespace {
vec ReadFromFile ( const char *name ) {
std::ifstream in ( name, std::ios_base::binary | std::ios_base::in );
std::string temp;
vec retVal;
while ( std::getline ( in, temp ))
retVal.push_back ( temp );
return retVal;
}
void printRes ( const char *prompt, unsigned long diff, unsigned long stdDiff ) {
std::cout
<< std::setw(34) << prompt << " "
<< std::setw(6) << ( 1.0 * diff) / CLOCKS_PER_SEC << " seconds\t"
<< std::setw(5) << (100.0 * diff) / stdDiff << "% \t"
<< std::setw(12) << diff;
if ( diff > stdDiff )
std::cout << " !!";
std::cout << std::endl;
}
void check_one ( const vec &haystack, const vec &needle, int expected ) {
std::size_t i;
std::clock_t sTime;
unsigned long stdDiff;
vec::const_iterator res;
vec::const_iterator exp; // the expected result
if ( expected >= 0 )
exp = haystack.begin () + expected;
else if ( expected == -1 )
exp = haystack.end (); // we didn't find it1
else if ( expected == -2 )
exp = std::search ( haystack.begin (), haystack.end (), needle.begin (), needle.end ());
else
throw std::logic_error ( "Expected must be -2, -1, or >= 0" );
std::cout << "Pattern is " << needle.size () << " entries long" << std::endl;
std::cout << "Corpus is " << haystack.size () << " entries long" << std::endl;
// First, the std library search
sTime = std::clock ();
for ( i = 0; i < NUM_TRIES; ++i ) {
res = std::search ( haystack.begin (), haystack.end (), needle.begin (), needle.end ());
if ( res != exp ) {
std::cout << "On run # " << i << " expected " << exp - haystack.begin () << " got " << res - haystack.begin () << std::endl;
throw std::runtime_error ( "Unexpected result from std::search" );
}
}
stdDiff = std::clock () - sTime;
printRes ( "std::search", stdDiff, stdDiff );
runOne ( boyer_moore_search, stdDiff );
runObject ( boyer_moore, stdDiff );
runOne ( boyer_moore_horspool_search, stdDiff );
runObject ( boyer_moore_horspool, stdDiff );
runOne ( knuth_morris_pratt_search, stdDiff );
runObject ( knuth_morris_pratt, stdDiff );
}
}
int test_main( int , char* [] )
{
vec c1 = ReadFromFile ( "search_test_data/0001.corpus" );
vec p1b = ReadFromFile ( "search_test_data/0002b.pat" );
vec p1e = ReadFromFile ( "search_test_data/0002e.pat" );
vec p1n = ReadFromFile ( "search_test_data/0002n.pat" );
vec p1f = ReadFromFile ( "search_test_data/0002f.pat" );
std::cout << std::ios::fixed << std::setprecision(4);
// std::cout << "Corpus is " << c1.size () << " entries long\n";
std::cout << "--- Beginning ---" << std::endl;
check_one ( c1, p1b, 0 ); // Find it at position zero
std::cout << "---- Middle -----" << std::endl;
check_one ( c1, p1f, -2 ); // Don't know answer
std::cout << "------ End ------" << std::endl;
check_one ( c1, p1e, c1.size() - p1e.size ());
std::cout << "--- Not found ---" << std::endl;
check_one ( c1, p1n, -1 ); // Not found
return 0;
}

File diff suppressed because it is too large Load Diff

View File

@@ -0,0 +1,2 @@
TU0AKgAfhPqScHN4dnZ2e3p5e3h7eXl4dnd1dnV3enp5dnd3dHV1dHNzd3l3eHh5
eXZ4dXd2dHNwcHFwcXBxc3h0dHN1eHVzcXV1dXV2c3h5dHV3eHVwcHF

View File

@@ -0,0 +1,2 @@
iBJbmMuLCBhbGwg
cmlnaHRzIHJlc2VydmVkLgAAAAA=

View File

@@ -0,0 +1,2 @@
q/y9PZ3uHj5ufo6UJDQ0NFQz8+RUZBQEBAOzo6Ozs4Nz06Ojs4Ojo9PT47Ojk0
Nzc7OjQ6NzU6OjgxMzg1OjY2NjU3NTU1Nzc3NTU1NzU

View File

@@ -0,0 +1,2 @@
TIzMjIyMjM0MjM1nTQzNTc3MzY1NDU2NzQ2MjEwMjU1MTQ2NzU0NDI1
NDMyMzQxMzQ0NDU1MjU2NTc5NzU1NDc4ODY1

View File

@@ -0,0 +1,170 @@
TU0AKgAfhPqScHN4dnZ2e3p5e3h7eXl4dnd1dnV3enp5dnd3dHV1dHNzd3l3eHh5
eXZ4dXd2dHNwcHFwcXBxc3h0dHN1eHVzcXV1dXV2c3h5dHV3eHVwcHF1d3V0dXJy
cXNzcHBwcHJyc3R0dXl7eHJycnF1dHV2d3h4eHV0cnRycXN1dXN0c3R0c3R0cXJx
cHNxb3B0c29scHFybm9sbGpscXJ1c3NycXN0cHFvb3JzdHBycG9vb29vb29ubXBt
bG9vcW5tbGptb3Fwb3Bwb25vbXFtbGtvbGlrbnBuamxsbW1rbW1vbm1ub3Btamxw
bWpsbG9xcG5ua2tpamhqZ2hnam5saWhsbG1nZmZnZ2lnamtxa2ppZWZmZWlrZ2hp
Z2hraWRmZ2psa2pmZWVkZmplZWZiYF1gZGVlYmJiY2RhY2NiYVxdW1xgXl9iZV9d
X11hXF5gZWJhYF5dXWFmYl9hXl5gXmBhZGFhYV1cYWFiX2FgXFxgYF5iYmNiYWRk
YWFjYGFgXl9jYmVlZGZiYV1cXFtbW1pYV1dVV1VWVlFQT1FRUVBRTkxLSktNTVFP
UU1RUVBSUlBPUlNTUVRWWFpcVldXWldXVVhYVlpbWV1dX1tbW11fYWFdXV5iY2Rg
YFxeYmNmZGJgYFxdYmdjYWFhYGJoZGReXF9gX2BhYWJhXltdXVtaXGJlYV5gYF9f
XVxcX2JiYWJkZmNjZGNhYmFcW15dXmBgX1xdYF5fXF5eX15bWV1dXl9eWlldXGJf
XmFgXVpcXF1dXlpdXl9dXWRlYF5cXFtfYF1eYl1hX1xbXV1ZV1hZWltbW1peW1lb
XlteW1xeXlxbXVpYW11dY19fW1xfX2NhXV5hZWNfX2FjZGJlZmVoaWtlY2FkXl5f
YWJjX19fX15dXWBjYmJeWlteXVlaXmBeXF1fXVxdXFtaW19dXFtfWllZWVxeXlxb
XV9eW1xcXF5cW1paVVdbWVteW1pbWlZeYV1ZV1tYVlVWV1hbWVhcWVhVWlhbWFtX
V1ZWWFtXVlZaVlRVVVdVVldWVlNRU1NTUVNXVVlZWVZVVFNWVlRTU1JVV1ZWVFRU
UVFVWVpZWlZWWFpYWllcXVpYWFdWWFxbWFlYWVhVVVRVV1dZWllYV1lcXVpcWVhY
V1VbW1tVVVdaXFpXVlZZW1leW1lWWFdaXVpXWlZXW1xdXFxgX1xYXVxcXFhaW1tb
WlxcWltdWldXVldXWVZVUVJVWFlcW1tcWVpgXF9hX11aWVpdXFxeXFtbX19aW1lb
W1paWlxdXVpaXVxeX1xdX2JjYV9gYl9cW1xbWFpeXl1gYGBgYFtdY2JhYmBgYGBe
YGJkY2NjYmNjYGNiY2JgX19hYV1gX2BgX19hZWRiZWJjZWVgYmFiZGRmaWdmYWJj
YmJjZGFhY2FhY2RkZmVmY2FhYWVnaWVjZGNhY2RlZWZqZ2doZ2RjZGRmaGVlZmZm
Z2dnaGhoZ2hmY2VmZWZjZWNlaWdlZmVoZ2hpamlra2hram1samtqZWpuc2tpa21u
bmtraWtqYWNmZmZmZGVpZ2p0kMLk8vv+/////////5drcHZ1dnd7fHt6end0c3V1
dnR0d3l3d3Z3fH16dnV2d3h0d3l2d3h4dXZ3d3d3dnBucW5vb3BxdHR3d3Jzd3Vz
dndzc3V6eHVyc3JydXZxc3Z1d3V0eHZ1c3Bvc3V0dnR0dXR0dHd4dnRxc3J0c3d3
dXNycXd1dnVzcHJ0d3h0dHFwcXFzc3N0dXFxcXFwcHFwcnFycHJwcHJzc3Fwc3Nx
cnRyc29ucHJ0cnBwb29ub3Fwc3R0cnJubnBycG1ucHBxcXBuc3FwbGpoamlsb3By
c25qaW1tcW1qbXFua25xb21vcG9tbG5qa2doaW1sbGpqamxsaWpmZ2VlZ2tqZ2Zn
amVoa2tvZ2ttamxpamlmZmdoZ2dnZ2traWZmaGlpa2loaGdmZ2ZoZmRnZ2ZmZ2Vl
ZmJiZWBhYmBhZGBhX2BfXVxfYmJkZF5dY2JjYWNhY2BgXl5gXl5dXl5cXFxgZGVh
Xl5eXlxeXl5iYl9fYF9iYWFhZWRkY2RgX2BhX19gY2VlZWRkZF1gYV9bWV1dWVxX
WldXVlZVU1BQUE5QUU9SUU5NUE9OTk9NT1FRUk5PUVRUUVJSVFVYWVpXVldVVlRV
V1dZXl9bW1pYWVhaXl9gXl5bYGJhYWFhX19jZGZmZGJgYF9eX19fYWRmX2RgYWBe
XmFhYWNhYmBeXV5eW1xdYF5dX2NiX19hX11dYmVoY2RlZWFeYF5fXV5hYGFgYF9i
Y19dXl5dYGNgXFZbXlxZWVxhYl5gYF9cXV1cXFxdX19gYVxZW11dX2NjXF5eXF5e
Xl9eYGJfXl9eW1xcX11ZW1xdW15eW11gXl1dW11cX15dXl1cXF5iX2BgYV9iYmJf
XF1mY2NiamZiYWNiY2JiYmVpbGdkYGBmY2VoY11dXFxcX15iYmFiYmBeW19hX19h
XV5aYlxZWlxcW1xcW2BfW1hZXF5cXVtcXlxbWldYW1xcXVpYWFlYWllbW1paWFpe
XFtYWFdUU1ZVWFhVWFteWFdYW1pYVlhVU1RVWVZXVVdXVVFSU1ZWVFNSVVtSUlJT
UlNUVVVWVVVWVVJWVVVTVldXXFlXVVlbVVNUWVtXWVtVVVZVWltZWltYVVVZWVlY
V1ZXWVVUV1dXWl1dW1tcX1lZWl5cXVtcWVVXXFxZXVxZVVRUWVlcWVZWWFhaWFtd
WV5YVlZZWVxbXFxdXFtbXl5dXVtbWV5dYF9cXl9eXF9iXl5bWlhbWltZWFpgXlpa
W15iXF1jYVtcYGBfXVpbXFxcWlxbXFtZXFxaWllaXl1aW11gXV5fX19fX19hXl5f
YGFgYWBhXmBiXlxfXFtcXmBgYmJkYWJgYmNgYGJiYWBfX19jZWBeYWJgYFxcY2Vj
ZGJfX2JiYWNmY2RjYmFhYWFjYWNpZmNjZ2ZkZGBiYmVmZ2VjYmNlZV9iZWhlZWJi
Y2JmZWdoZWVoZmdrZ2VmZmhmZGRkZ2VmZmVkZmppZmVnaGhqamhiZmZnaWdnamZm
ZmtubGtpZWhna21rZmRpaWVlZ2l0bGtrbG1obmdmamZnaGVkZGNobYekwePx+///
////////l2pzdnh3fHt8enp5fnl2d3Vyc3d5eXd1d3d3eXx+eHp3eHR0d3d6enl1
dHNzc3d1dXNwcHJ0c3Byc3V3eXVycnZ5enl3dnh3dnJxdHZ3dXh8eHl1dXZ3dnZ1
dHV0ent2dXl3dXV1d3h3dnZ3enV0d3d0dXN3dXZ1dnd3d3h6eHZzc3JwcnN0dHJy
cXFub3FycW9vcHBvbGxsbXFzcHF1c3N0dHR0c3Bvc3N1cnFvcW9tbXFzcm5ub3Bw
b21ucXBxcXBvc3Bvbm5sa25sbW1vbnJ0b2trbWpqbGtsbnFxcG9vbm1xbm5tbGpp
amtqbm1rbW9sa21taWhoZmlqaGlramxqaWdraGdqaWluam9ua2psamhkZmxpaWpq
aWVlZWdnaGZjY2RpZmZnZmZmZ2ZnZGFhZWNgZGJhY11dXV5hXF9lZGRiY2JhYV5f
YGZgYF5fYWJgYmBgX15gZF9eYF1gYlxeYV5fYV5eYF5gYWJkX2JhZGNlZGJjYmFh
YWNgY2VhZGZkY2JgYWBjY15fXFtaWllaXFlYVlNRUVNTUU5PUlNSVlRPU09PUVJS
U1FNT1JVUk9RU1NRU1NSVFRWVllWWFtXWFhaWlpeXl1hYV9cXV5fXl9gXmFgYGBh
ZmJjYmJjYV9fX19dYWFiZmRiYWBeX2FcW15fYWBfXmNkX11cXF1cXVxfYl9hYWJd
X2BhY2JjX2BkZGFgYWFfYWFgYF9eX2JiZGVjY19dYF9eXV1eXF9hXmBeXF1fXV9b
XGFhY2FkX11dW1peXl9hYWJgX19jYV5dYGFgYGBdWV5cXV9hYGBcX2BhYF5gZWBb
X19dXWBeXl1eYWNhXl1eYGFhYGFgYWFhZGNiZGZoZWdnZWNgXWFhX2NlY2NjYGBl
Y2NjY11bXl9eXmBiYGFgXF9kYF5iYF9iYl9cW15aWV5fXFtaWVpdW1xfYGBfXV5d
XFtcWlhXVlZWWFhYV1ZWV1daWlhbWlpcXFhaWFdYVldYWFlZWWFYWltYWVhSVFdV
VlpWV1RYV1VTVFRYVVRWU1RUVVhWVVRUVFZXVFVXV1VWV1ZYV1lcbltbWV5ZWlpX
V1VSWFtfW1laXV5bWFpZWlpYWVhYW1hYV1daWVlZV15dWlxgXVpZWV1hXFpbW1dY
WlpZVldXWlpWVlZXWlhaWVlZWVpZW1xbWltcWVhaXVxdWVxZWVtaX2BfXFlaWVte
XV5dXV9eXF9bW1xbXl9hXFdcXlxbWVpbXFpcWF1gXV9gYF9aW11cX15dX19gXFtY
WVtZW1tdXWBiYWBfXV5cXV5dX15eXV1iZWRhYWFiYF9eYmBeXV5dYWBdXWBlY2Fh
YWRfYF9hY2RhZGJjZGZjYmJfYV5fZGJkYWBgYGBjY2RlaGNhY2BjYF9eYWJgY2Vk
Y2JlZWRhYmRlY2FjY2RjY2RjY2NjYWBkY2NjZGVjYWRnaGhramtqZmdnZmhoZ2pn
aGhoZmhpa2lpaGhoZ2hlZmdqaGZsbWhpamlqamppa21qaGhmaGxqZWVra25sbW5p
aWhraWprbW1pZ2ZoZ2hsfKXG4/D7//////////+UbnR5e3t6eHmAfH58eHZ2dHd2
d3x3dHZ2dnl4eHt8fHh4dXVydXR3eXd2dXR4d3Z1dXZ1dnhydHd5d3ZzdHV4dXR2
eX13dnV2dHN1eXh4eHd3dnd2d3Z3dXZ3dXZ3eXh5dnR4eHV2eHt8e3l1d3d1dndz
dXV2d3Z1eHh0dXR2d3V0dnNxcXFvb29yc3FucnJycW9ycnBvbG5ycXF0cnNyc3Nz
cnFydHFvcHFycnNucXJvb3FzcHBxc3NxcG1ucG9wb3NxcXJwa2xtbXFwbnJtbnFv
b25uamtqbG1scHJwa25tbXBycG9tbW5vbnBvb2xtb2xxbmtsbGtpamtrbGtnamlq
a2pnaGhmZmptaGhoaGxqaGhpaGhpaWlpZmVkZWdoZ2lmY2RgYmhmamdlamdhYWNg
X2BgYmNhYV1eYWFmZGRkZF9cXWBgX19fY2NdYWFiYWJhXl5kYWJhXF5eX19hYmZi
Xl1gYmJiYV5iY2FhYmRhX2BlYWFiY2FfYWJhYmRjZGJeYmNmZGBhYmFaWVpaXFtZ
V1ZUU1NSVVVXWVNSUE5NT1JPTk1NT09OUlVOTk1PU1NRU1JTVFRRU1NWV1dXWlhb
W19bX11cX15fXFpeXV1dXV9fX15hYGBhZWJhX2FhYGBeXmFmZmJhYV9fYWFeXl1b
XFxcXWJgYGFgXV5eW1peX2BgYF5iY2RiYV9gYmFhX2BhYmNiYWBhYWJfYWFfYF1f
YWBgY19fXV5kYVlcX2FgYF1eW11gX15dXGBgX11hXltbW1teX2FdX15cW11cXF1e
X2BfYGRmW1tfYFxeYWNiX15dXmBcXF5gX2RfW2BjYmFhY19bWl9hXl9hYmBeYWVk
YmRiYmNjY2NjY2FjZGNgZGJjYmBfX19eYmJeXl1eXF5gXV1dXV1cXFtbW15fXV1e
XlxdW1xeXmBbWVpYVltgYF5dXV1eWVlbW1xZVlZVWFhcXl1aWllWWllbXVxbWFha
WFpbW1lZVldXVVZdV1daW1hYV1hVV1hTV1VUWFlXVVNVVVJSVVVWVlJWVlZWVFRW
U1VVUlVUV1RWUlJYVldXVFdcXVlYV1JQVVlTVVZXV1ZTU1dYV1VUWV5bV1RWV1pY
WFlbWldZWlpaWFdZXVlcXlpcXFlcWltfW1hZWltZXVteWFRSV1hZWlpZWFhXWFla
WFheWVtZV1laW1tcWFlcXF1eXVtYWlpbXF1dX1xbWltcXl5hYVtZWl5ZWVxeXV5d
XltaVlhaWVxcW1pbXV5eXlxdXV9eWllbW1tfXlxeXWBeXGFeXl5gX2BfXlxgY2Ji
YWFhZWJgXWBfYV9dXl1cX2BeXl9eXFtcX19gX15hY2NgY2NnZWFjY2FkZGJjZGJi
Y2BhYmNkY2NhYWJjZWJiYGJkY2BhZWVmYmRkZmVmZGNiX2FkZGNkZGJjZWRlZGJi
YmRjYmhjYGJmaGlmY2NnZWhlaWtramhmZmZqZGhpaGZnZmRnaGloZGhqbW9tamdp
bGtubGlsbmxpbW9wbGtra3ZoZGdpamhnZmhpaGhtbW1ra21qaGt+psnk8Pr+////
/////3ZnbnV6fHh2eHp7fHx6d3h3dXV6eHd5dXNzc3h5eXl1d3d3d3h2dnd0dXR0
d3h5eXh6dnV1cXR1dHV1dHR2d3h3d3p4enp5c3Z3dXV0dXl4dXV4eXt5dnZ0dnp5
eHZ4dnd1dnNzdHJ4fHx8eX16eXh2dnR0dHV2eHV0eXRycnB0cnNwc3dzb3FvcXNv
b3Fyc3Bxc3JwbmxucXJycnRzcXBwdHV1dnVzdHJvcnFycnZxcXFxcXJwb3BvcXRw
bXFvbXBubGpwcXFtbG5ub25xcW9rbG1tbGxta2xrcnRxcm5qaWxra25wb3Byc3Zw
b2xsbWtub21ra2xpam5tbG9ybGxrampramlpbHVza21maGxqaGhnaWxrbHBsa2tp
amhnZ2ZmZWViYGNjZmRjZWRoZ2VhX2JjY2JiYGFhYGBfY2dnY2FiY2BiX19fX2Fh
YWJgY2JjYGFgYV9dXF5fYFxfYWJkYmJeX2BiYmFiYGFkZGJfX19iZGlhYGBkZGJj
YmRlZWRhYWBhYmBcXV1dXVxbW1xbW1ZXVFBXVFNUUFRUUk5RVldQT1FPTkxMT1JR
UFFRUFBRU1NRUFBRU1RRUlRVUlNWWFhaWV1eW1tdX2BgXllYXV1bXWBgZWNgYV9g
X2JfX2JlY2VmZ2RmZWZiYl9fX19hX2BeW15hYF9dW15gYWRiXVlbXF9hYmNjZWBm
YmFdY2RkYWFhXV9gZGFhY2JeY2FeXmFgXl9iYl5dYGFcX15dYF5dXVpZXGBfXl1d
W19gYF9cXF1cXl1bX2JeXl9aW11cXF5fYGBhY2ReYF9dYWFjYmFfXlxcXVtdXlpe
X19lY2NgYWBeYmJdXl1hY2JiYl5fYGBhYmRkZGJjY2JjYmJiYGFiYmBfXV5eXV1g
Y2VgX1xbW1teXVpZW15fXVxeXVteW1lZW1pcXFxfW1tZWmBeWl1eXV1eXlxYWlxc
WlhZWFlYWFdbWltdWVlZXFlaW1xaWFdYXFtaWFhYVVZZWVhYWVdWVVZZWFxXW1lU
WVhVU1dXU1JVVVZYWVlaWllYWVZWVldWV1hWVlhXXllYV1ZYVlZVW1lYWFRUU1RX
VlZYWVlYWFhTWFZYW1xaW1lYWVtZVVZXWVpXWltZXFxaWFpXWV9fWltYVVhdWlla
WltZV1hYWVxbV1hWWFxbWl1cWlddWVlbW11aV1daXFlZW1xbWlpeW1pdW1lXW11e
W1tbXFhaXl1bX19cW1tcXF5cXF1aV15eWlpbWl5cXlxcWltcXFxbWlpcXFxdXV1i
X1tcX11gX2BhYWNhYF1eYmJfXmFnZWBeX2JeX2FfX2FjYWNeX2BfYmRkYWBfXl1f
YmNgX2BiYGFhYmNmZmZlZmRjZGVlZWZkYF9kZGNfXl9gX2BjZWVlYmJhZGJlZGJl
Y2JkZmRjY2ZnZGVkaGZlamJiYGRlZGNhY2hoZGNiaGVpZmtpZmBkZ2plYmRnaWdl
ZWdpZGZnaGdkZGlta2pqaGlnZ2RoamlmZ2pta2lqa2tqbG1sbGtqZmtsamhqbGlr
aGloa2dnbmpwZ2lra3uly+Hv+P7/////////cHR9e3x6d3Z3eX16eXh3d3p6dnh3
e3l0dnVxc3Z3dnd5dHV2eXh1c3N0d3Z4eXl8fXyAenl4c3RzcnJ2enZ2dnV0dnl+
e3d0c3V2dXR4eHh2dnZ1eHZ2dHh4d3V3dXR1dnZ1dHR0dHd3eX97eXl2d3R1dnd2
dnd5c3JzdXJ1c3Z3dXZ2eXRwc3FycHBwbnBvbnB3dXV1c3RwcW9ydXJzcnR3eHZ1
eHR0dXRzb29wc3FwbXBtb21ubWxtcnNxbm1rb3Fubm9ubm5vbmlqbmxpamxvbW1s
bm9vb3FycHJsamtra21rbW1vcG5xb25tbGlpbWttbmxsbGxpa2hoamtrbWxqamxt
bW9ub21rbnBoamdlZ2ppbW5tbW1vbmxqZWdmY2VlZGNjZWZlYmVjZGBiZGBfYmJp
Z2NkZWNgX2NjYmNhX15lZWBdYF5iXVxbYWBgYmJgYF5gX15cX19jY2BeXmBfYGJi
YV9gYmFfYWJjYF5gY2RiX2FdYWJlZGRkZWVmZ2NhX2FhXmNiXVtcXV1dXVxaWFZX
WFVUUlNTU1VTVVNVT05QUFFNTU5MTU9RT1JTUFBRU1BRU1VUVVVTU1NWVFZaW1pY
WlpaX11eX15cXVxdXlteXF5hZF9fX2BiYWFgXmBhYmJiZGVkY2RjYGBfXWBiXVxg
YWJhX19jYF9hYGFfXFpbXWJjYmFgYGFiYmNiY2VhXV9fZmNkYWFiZGNjYF5cXVtb
Xl5eX2RkZF9eXF5dYF5hXlxbXFlYW2FiY2JfYlxZXl5dXV9dXV5gXl1cW1tbWVpd
Yl9fYl9eY2FdXV5eXlxdXFtbXmBgYGJiYmhlX2FeXl5fYF9fX11fYGBiYGFiYWFl
Y2NiYmBiYWJnZ2FfY2NgX2JkYmNlYl9fYFxdXV5fXVxZWlpdXF1cYF9gX19eXlla
XWBiXlxYWFxcXVtdXFpfXmFgW1lbWlpYW1pbW1tZWFtdYF1aWVpZXWFfWFZUVlZX
WVtaWFZWWVZUV1dYWFVUVFZVWFxcXVtaW1hWVlVUU1ZXWVhbWFlWVFhaW1lYVlVU
V1pYVllZWFdaW1pYWFtVVlpcWlRUWFdXWVlWWVtbW15YWVtbXFtXWllWVVdZVlZY
V1hZWFlYV1daVVZZV1tcXF5cW1paWVheXl5dW1xcWVpbWFhXWllYW1hZXlpWXFxc
W15aWVpZWllZW15dWlxbW1lbXVxaXF5cXFpaWlpbXVtcXFxcXl1aWFpcYWNfXFxc
XF1dX2FaWVtaWVpbXVxbVltaWVpfXF1cYWBeYWFeX19dX2FfXmBfX2NqZGFfYGJg
YGBjY2VhYGFmZGFgYWJgYV9eXl5fYmNiYWJiYF9eX15gYGBiYGFjZGNjY2JjZmdj
ZGFhX2JfYGJhY2RjYWRjYmNiZGBkZmZmZWRkZmVmZmVlZGlmZ2lpaGZmZWdkZWRl
aWhjY2FjZmNmaGlnZmtqZ2dkZWdkZWVkZGdkZ2hpamhoZ2ltZmZnZWVlY2dpamtr
a25wbWppbW9vcHFxb2xxbGxva2xoamlpaWprbGprb21mZ2h3gqDN4u/3/f//////
//9ueHx9fnx5eHl8eXp7fnl4eX14e3l5d3l3dHV0dXZ4dHZ1c3N0dXRzdnR3eXd4
dHV6e359eXd4dnZ5d3d3dXZzdHZ0eHh3d3h3dXh1cnB0c3R2d3Zyc3R4enp3eXh4
dnd2d3p7e3x6dXh2eHd2dHd5dHR0dXd5d3V0dXR1dHRzdnZ3eHhzdHd4eHJxbmxu
b29wcnJzdnV0dXBydnNxcHFwcnV2dHd1dHV3dXRycnRzdHFtb3FxcXBubm9wbG9w
b29vbnFycXBsbW1xc3Jtbm9ubW9ubWxtb25wdG9tbm1wcWttbW5sbWtwbnFsamps
bGtoaWtvcW9tbGxsa25vbWtoaWtsa2psa2tpbWxqbGloZ2loaWtsbG5tbGxraWlq
a2lnZWVlY2JiYGJnY2JkZV9hY2JjYmBga2dhYWNkY2ZkYWBfXmBgXlpdYl9bW11h
ZGRhX19fXGFcXWFfX19hXmBhYGBiZGZlY11cXWNkY2ZmYmJgXl9eXmFhZGFjY2Nm
Z2hmZGJjYl9eYGNhXl9eXFpcXVxbXFhWU1FRUlNSUE1OUFFNTE1NTUxPT0xKT1JY
U1JSUE9SVFZTUlJTVVdZWlhZWlhZWVhdXF9hXV9cXVxeYl9dYWBdXV9gYl9fXmBg
ZGNfX2NjY2NkYl9jYGFjY2FfYV5gYV9gY2JhYV9lXWBiXmFjX2BfXV9eXF5dX2Bf
ZWNkZWhmX19dYF9jYmFfY2NhXF1dYV1dXFxdXl9gYGFdXGBeXmFhXFtdXVxcXl5g
YmFeXVtcYGBcXl9dYFxfXl9fXl9eXV1eYWBeXVxdYGNhX2FfYWFgYV9eYGNgYWJj
X19gX11cXl5dXl5hX19hYWFkZGJiZGNiYmJjYWFjY2FfXmFkY2RlZmdhX2BhXmBi
ZGRiY19dXVxZXF1eXV1gYV9eYl5hX19eX2JdWl1cXVxcXmFeXF5eXV5bXmBkXFla
WFtbWltbWllbW1hbWVlZWltZW1hXWFdaWlpZW1tVVldYV1ZXWFRWU1NWV1hYWVpY
V1hWVlRTV1ZXVlVTUVNaVlVUWFdVVVNUWl5bWldYWFpbWlhZV1ZYVldcWltaWVdY
WVdVV1lbW1hXWFpXVVZWVlVUV1dZVVVVVVZVWFpXVlhaWlpYWFtaXWFdWllZWltb
W1pbW1lYWVxZWFhUVlhZXF9bWVtYXFxcW1pdXV5YWFlXWltcWldaWVlbW1pXV1pa
W15hXVxgXVlZW11aW1laW11bXF1ZWmBcXFxdXF9cX15aWlpZXFteWl1gYl9hW1la
Xl1eXV1eXV9dXl1dXV9hYGFhX11dX2BgX2RlZWNlYl9hYWNgX2BfW1tdXV9iZGJg
YF9gYGNiYGFjZ2FgZGFgYWVhY2ZkZWdgYGBmZGFgYWFiYmBfY2RlZWRkZGVkYmVn
Z2RnamdoZ2VjY2ZnZGJiZmplZmVlaGNkZ2ZmZWFiY2ZmZ2trbGtpZ2hqa2xqaGZn

Some files were not shown because too many files have changed in this diff Show More